Busch Lab

ZMP

blnk

Ensembl ID:
ENSDARG00000042722
ZFIN ID:
ZDB-GENE-040702-4
Description:
B-cell linker protein [Source:RefSeq peptide;Acc:NP_998003]
Human Orthologue:
BLNK
Human Description:
B-cell linker [Source:HGNC Symbol;Acc:14211]
Mouse Orthologue:
Blnk
Mouse Description:
B-cell linker Gene [Source:MGI Symbol;Acc:MGI:96878]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa14297 Nonsense Available for shipment Available now
sa42310 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa9203 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa14297
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062684 Nonsense 126 490 6 23
ENSDART00000132281 None None 57 None 3
Genomic Location (Zv9):
Chromosome 13 (position 51520416)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 50230078
GRCz11 13 50544997
KASP Assay ID:
2260-7033.1 (used for ordering genotyping assays)
KASP Sequence:
AAGCCCACAATRTGAAGCCCTTCACTGTGTGTCCGTCCATCACAAACCCC[A/T]GAGGAGAATATGTGGGTGAGTCGCACTCAAACTACACTCARCTCTGTGTW
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42310
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062684 Essential Splice Site 218 490 10 23
ENSDART00000132281 None None 57 None 3
Genomic Location (Zv9):
Chromosome 13 (position 51515590)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 50225252
GRCz11 13 50540171
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGTGCTCTAATTCTGCTTTTCAGATTTCTATGAGATTCCTGACATGAAG[G/A]TGAGCTTTAATCAACACTAATGTACTTATCCATTGCAAAATAAAATTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9203
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062684 Essential Splice Site 226 490 11 23
ENSDART00000132281 None None 57 None 3
Genomic Location (Zv9):
Chromosome 13 (position 51514478)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 50224140
GRCz11 13 50539059
KASP Assay ID:
2260-7031.1 (used for ordering genotyping assays)
KASP Sequence:
TAAATACATGTTTGTGTTCAATTTCAGGWGARTTCTGAATCTAAGAAAAG[G/A]TAAAACCMCTTCAARATAAGCCAYCTTTTTTGTATTTTATTTATATTACA
Associated Phenotype:
Not determined