Busch Lab

ZMP

adipor1b

Ensembl ID:
ENSDARG00000042717
ZFIN ID:
ZDB-GENE-040426-2896
Description:
adiponectin receptor protein 1 [Source:RefSeq peptide;Acc:NP_998665]
Human Orthologue:
ADIPOR1
Human Description:
adiponectin receptor 1 [Source:HGNC Symbol;Acc:24040]
Mouse Orthologue:
Adipor1
Mouse Description:
adiponectin receptor 1 Gene [Source:MGI Symbol;Acc:MGI:1919924]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa12228 Essential Splice Site Available for shipment Available now
sa16380 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12228
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062682 Essential Splice Site 145 377 4 8
Genomic Location (Zv9):
Chromosome 8 (position 29235482)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 28367392
GRCz11 8 28358632
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CATCTTCAGGATTCATACTGAAACTGGAAACATCTGGACACACCTGCTGG[G/A]TCTGTGCTTGAGAAATATTACATTTYGACTTGATACTAACATYGTCGTTT
Long Flanking Sequence:
TTCTAAATGCAAAGATAAAATTTTTTTAGGGTGCATCAGCATCACCTGATGAGAATGAAGATGAAAAGGAAGAAGGAGGTTTGCGGGTGGTTACACTGCCCATGCAAGCACACCATGCCATGGAGAAGATGGAGGAGTTCGTGCATAAGGTGACAAATGACACATCTTCAACAGTCTCCTATACTGACAGCTTTCCAGCAGTGATGTTTCGTGATATTTATTAATTATTTATTTAATTTATTTAAACAATTAATTTTAATTAAATATTATTTAATTGCTATTTCCAGTTTGAGTTGTTTGCATTAATACAAACTCTTATAATTCCTAGATATGGGAGGGACATTGGCGAGTTATTCCATACCATCTCCTCCCCGACTGGCTAAAGGACAATGATTACCTTCTGCATGGGCATCGTCCACCCATGCCGTCCTTCCGAGCCTGTTTTGGGAGCATCTTCAGGATTCATACTGAAACTGGAAACATCTGGACACACCTGCTGG[G/A]TCTGTGCTTGAGAAATATTACATTTCGACTTGATACTAACATCGTCGTTTTTGAAAGGTTCATCAAGAGCTGGAGTTTTCTCAATATTAAATTCCATGTTCGGTGATAATATGCACTTTACAGAAGTTTAGTGTCACTGTAATAAGTTAAAAAAGGCCTTATTCATTTGGTACATTAAATTACAGTCAAAATTGTAATATTATGAAATAATGTCTTCTATTTAAATGTAATATAAACTGTAATTTATTCTTGTGTTGGGAAGCTTAATACTGAAGCAGCCACAATTCTAGTTCTCAGTGTCTTTATAAGTCATTCAAATAAGCTAATCTGATGCAACAGATATCTTTTATTATTATCAACATGGAGAACAGTAATTTCATATGAATTTATAAAAAAATTTAATCTTCATTGCATTTCAAATGTCTTAACTGTCACTTTTGATACATTTTGTCCTTGCAAATTAAGAGCATTAATTTCTTTTAACAATGTATTACACCCCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa18920
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062682 Essential Splice Site 208 377 5 8
Genomic Location (Zv9):
Chromosome 8 (position 29234549)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 28368325
GRCz11 8 28359565
KASP Assay ID:
2260-0730.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTCACACAGTCTACTGCCATTCGGAGAAGGTTTCCAGAACTTTTTCCAA[G/T]TAAGTGATGATAGTTTGCTTGCATACGATGGATAGGATTGATTTAAAGTA
Long Flanking Sequence:
CACTTTTGATACATTTTGTCCTTGCAAATTAAGAGCATTAATTTCTTTTAACAATGTATTACACCCCAAACATTTCAACAGTTTTGTATGTCTTATAACCCCAGGCTTTTAAAGAAAGGCATTTTGCACCTTTATGAATTTACAAGACAGATTGTGTGATATTTTTAATCTGATAATCTGATATGTGTGAATCACTGCCCTGTAGACGACATTAAGCACACCACTTAGACTTCAAATGTCAGTCAGACCTGTAATTATGCTTCTGAGGAGTCATTTTGGAAGCTAATTAATCTATCGCAATGTCTCCCTGCAGGCCTAATTCTGTTCCTCTGCTTGGGCACACTGACAATGCTGCGGCCCAACGTGTCGTTCATGGCACCCGTGCAGGAGAAGGTGGTGTTTGGCGTGTTTTTCCTGGGTGCAGTGCTTTGTTTGTGCTTCTCCTGGCTTTTTCACACAGTCTACTGCCATTCGGAGAAGGTTTCCAGAACTTTTTCCAA[G/T]TAAGTGATGATAGTTTGCTTGCATACGATGGATAGGATTGATTTAAAGTAGTTACTCACCCTTATGTTGTTCCATTGCTGTATCCTTTGTCTTTAAACTTTAAAATAAAAAAATGTTATGCTTATGCTTGCCTAAATAAAAAAAACACACAAAAGTAACGCTGAATTTTTCCATTTGATCATTGCTGGATATTATAAATGTTCTTGGGGTATTTGATTGGGTTTGGTAAAAACAATTCAAATCTAATATCCCATTTAACCAAAATTTTGAAATGATCGTTGGTCTTTGTGTAAAAACTGCACATTCGTGAAACTTTGTCAGCATTCTGAGGTGCACAGTGTGCAGAAGTCACCAACTTTTTGCAGAGCCAAGACCTCCAAACTTTGTTTGGTCGTCAGATTAGTTTAAGAAGAGTGCATTGATAACTTTATAGAATGGGTTTCCATGGCTGATCAGCTGCTTCCTGGCCTTGCAAAGTGGTGTACCGTGGTGTAAAGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16380
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062682 Essential Splice Site 208 377 5 8
Genomic Location (Zv9):
Chromosome 8 (position 29234548)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 28368326
GRCz11 8 28359566
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTCACAYAGTCTACTGCCATTCGGAGAAGSTTTCCAGAACTTTYTCCAAG[T/G]AAGTGATGATAGTTTGCTTGCATAMSATGGATAGGATTGATTTAAAGTAG
Long Flanking Sequence:
ACTTTTGATACATTTTGTCCTTGCAAATTAAGAGCATTAATTTCTTTTAACAATGTATTACACCCCAAACATTTCAACAGTTTTGTATGTCTTATAACCCCAGGCTTTTAAAGAAAGGCATTTTGCACCTTTATGAATTTACAAGACAGATTGTGTGATATTTTTAATCTGATAATCTGATATGTGTGAATCACTGCCCTGTAGACGACATTAAGCACACCACTTAGACTTCAAATGTCAGTCAGACCTGTAATTATGCTTCTGAGGAGTCATTTTGGAAGCTAATTAATCTATCGCAATGTCTCCCTGCAGGCCTAATTCTGTTCCTCTGCTTGGGCACACTGACAATGCTGCGGCCCAACGTGTCGTTCATGGCACCCGTGCAGGAGAAGGTGGTGTTTGGCGTGTTTTTCCTGGGTGCAGTGCTTTGTTTGTGCTTCTCCTGGCTTTTTCACACAGTCTACTGCCATTCGGAGAAGGTTTCCAGAACTTTTTCCAAG[T/G]AAGTGATGATAGTTTGCTTGCATACGATGGATAGGATTGATTTAAAGTAGTTACTCACCCTTATGTTGTTCCATTGCTGTATCCTTTGTCTTTAAACTTTAAAATAAAAAAATGTTATGCTTATGCTTGCCTAAATAAAAAAAACACACAAAAGTAACGCTGAATTTTTCCATTTGATCATTGCTGGATATTATAAATGTTCTTGGGGTATTTGATTGGGTTTGGTAAAAACAATTCAAATCTAATATCCCATTTAACCAAAATTTTGAAATGATCGTTGGTCTTTGTGTAAAAACTGCACATTCGTGAAACTTTGTCAGCATTCTGAGGTGCACAGTGTGCAGAAGTCACCAACTTTTTGCAGAGCCAAGACCTCCAAACTTTGTTTGGTCGTCAGATTAGTTTAAGAAGAGTGCATTGATAACTTTATAGAATGGGTTTCCATGGCTGATCAGCTGCTTCCTGGCCTTGCAAAGTGGTGTACCGTGGTGTAAAGCACA
Associated Phenotype:
Not determined