Busch Lab

ZMP

ENSDARG00000042698

Ensembl ID:
ENSDARG00000042698

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa11109 Nonsense Available for shipment Available now
sa39277 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa11109
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122414 Nonsense 168 370 4 8
Genomic Location (Zv9):
Chromosome 20 (position 23831888)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 23950689
GRCz11 20 23849789
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCAACTTACCAAGACAAGACGCTAGACCAGTTTTTCCTCAATACACACAA[C/T]GTAAGTCTTAAGATGTGTTTTGGTTTTCACTACAGTKCAGTTGGAGGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39277
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122414 Nonsense 233 370 5 8
Genomic Location (Zv9):
Chromosome 20 (position 23830733)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 23949534
GRCz11 20 23848634
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATTTACCCAAATGAAGAGGTTGAGAGTCACAAGAACAGAGTGAAACTGT[T/A]AAATCAAAACACTCCAGGAAATCTGTCTCTGCTCATATCAGCACTGACCA
Associated Phenotype:
Not determined