Busch Lab

ZMP

cadm1b

Ensembl ID:
ENSDARG00000042677
ZFIN ID:
ZDB-GENE-080327-34
Description:
cell adhesion molecule 1b [Source:RefSeq peptide;Acc:NP_001107024]
Human Orthologue:
CADM1
Human Description:
cell adhesion molecule 1 [Source:HGNC Symbol;Acc:5951]
Mouse Orthologue:
Cadm1
Mouse Description:
cell adhesion molecule 1 Gene [Source:MGI Symbol;Acc:MGI:1889272]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa10395 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10395
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062603 Nonsense 94 370 2 8
Genomic Location (Zv9):
Chromosome 15 (position 17778876)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 18942690
GRCz11 15 18878422
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAGGGCCGCTACGYGTGTCAACTCTACACGGATCCACCGCAAGAAGCCTA[C/A]GCCGACATCACTGTACTGGGTATGATTATCGATTCACCTCATTGATTCCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28430
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062603 Nonsense 329 370 7 8
Genomic Location (Zv9):
Chromosome 15 (position 17884334)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 19048148
GRCz11 15 18983880
KASP Assay ID:
2260-8318.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGTGTTCGCCATGCTTTGTCTCCTGATTGTTCTTGGCCGATATTTCGCC[A/T]GACACAAAGGTAAATCACAAGCATGATTCTGGCTTGGCCTGATTTTTTTT
Associated Phenotype:
Not determined