Busch Lab

ZMP

tert

Ensembl ID:
ENSDARG00000042637
ZFIN IDs:
ZDB-GENE-080405-1, ZDB-GENE-080405-1
Description:
telomerase reverse transcriptase [Source:RefSeq peptide;Acc:NP_001077335]
Human Orthologue:
TERT
Human Description:
telomerase reverse transcriptase [Source:HGNC Symbol;Acc:11730]
Mouse Orthologue:
Tert
Mouse Description:
telomerase reverse transcriptase Gene [Source:MGI Symbol;Acc:MGI:1202709]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
hu3430 Nonsense Available for shipment Available now
sa25076 Nonsense Mutation detected in F1 DNA Not yet available
sa6541 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
hu3430
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098884 Nonsense 156 1088 3 19
ENSDART00000098893 Nonsense 164 1098 2 16
Genomic Location (Zv9):
Chromosome 19 (position 608257)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 629744
GRCz11 19 629553
KASP Assay ID:
554-0052.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGGTACCTGCTGCAGGACTGTGCCGTTTTCACCACCGTCCCGCCATCGTG[T/A]GTTCTGCAGGTGTGCGGAGAACCTGTTTACGACTTGCTGATGCCGCGCTC
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa25076
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098884 Nonsense 231 1088 3 19
ENSDART00000098893 Nonsense 239 1098 2 16
Genomic Location (Zv9):
Chromosome 19 (position 608480)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 629967
GRCz11 19 629776
KASP Assay ID:
554-7560.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATATTTCGGTAAAGCGGCGGAGGGTAAAGGAAACTGTGAATAATAATAAC[G/T]GAAATTACAGATCTCGGTGTTTTGCAATTTCTAAAAAGAGAGCGAGAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6541
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098884 Nonsense 440 1088 3 19
ENSDART00000098893 Nonsense 448 1098 2 16
Genomic Location (Zv9):
Chromosome 19 (position 609109)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 630596
GRCz11 19 630405
KASP Assay ID:
554-4929.1 (used for ordering genotyping assays)
KASP Sequence:
RAGGATATGGAGTCTCTGCTGAAGTCACACTCGTCTCCWTATAGAGTTTA[T/A]CTGTTYGTCAGGGAGTGTCTGCGCYATATTATTCCCCACGAGCTCTGGGG
Associated Phenotype:
Not determined