Busch Lab

ZMP

acbd3

Ensembl ID:
ENSDARG00000042623
ZFIN ID:
ZDB-GENE-040426-1930
Description:
acyl-Coenzyme A binding domain containing 3 [Source:RefSeq peptide;Acc:NP_998162]
Human Orthologue:
ACBD3
Human Description:
acyl-CoA binding domain containing 3 [Source:HGNC Symbol;Acc:15453]
Mouse Orthologue:
Acbd3
Mouse Description:
acyl-Coenzyme A binding domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:2181074]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa37067 Nonsense Mutation detected in F1 DNA Not yet available
sa23733 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37067
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062525 Nonsense 55 523 1 8
ENSDART00000062528 Nonsense 55 210 1 5
ENSDART00000127058 Nonsense 55 210 1 5
ENSDART00000130714 Nonsense 46 513 1 11
Genomic Location (Zv9):
Chromosome 20 (position 30728648)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 30799861
GRCz11 20 30702740
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCGAGACGCCCGATGGCCAGTCGGCGGAGCAGAGCCACGAAAACCCTGAG[C/T]AGAGTGTCGATGGGGAGGAGGGCGAACCTACCAGCAGCGCTAATATCGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23733
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062525 Nonsense 119 523 2 8
ENSDART00000062528 Nonsense 119 210 2 5
ENSDART00000127058 Nonsense 119 210 2 5
ENSDART00000130714 Nonsense 110 513 2 11
Genomic Location (Zv9):
Chromosome 20 (position 30730827)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 30802040
GRCz11 20 30704919
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATAAACTCCGTCTGGTAGCCCTCCACAAACAGGTGTTACAGGGCCCTTA[C/A]AACCCAGATGCTTCCCCTGAAGTGGGCTTCTTCGATGTGTTGGGAAACGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4909
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062525 None None 523 None 8
ENSDART00000062528 None None 210 None 5
ENSDART00000127058 None None 210 None 5
ENSDART00000130714 Essential Splice Site 199 513 5 11
Genomic Location (Zv9):
Chromosome 20 (position 30736573)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 30807786
GRCz11 20 30710665
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGGTCTYTTGAGATGCATGTTTTAGAATAATTYACCAGAGCAGCAAAAAG[T/G]TATTGGCCTTTAATTAAACAACTTTTTAATCCTGAACTTGTCTTGTTTTT
Associated Phenotype:
Not determined