Busch Lab

ZMP

sema3h

Ensembl ID:
ENSDARG00000042616
ZFIN ID:
ZDB-GENE-990715-8
Description:
semaphorin 3h [Source:RefSeq peptide;Acc:NP_571125]
Human Orthologues:
SEMA3A, SEMA3C, SEMA3D, SEMA3E, SEMA3F, SEMA3G
Human Descriptions:
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A [Source:HGNC
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C [Source:HGNC
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3D [Source:HGNC
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3E [Source:HGNC
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F [Source:HGNC
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3G [Source:HGNC
Mouse Orthologues:
Sema3a, Sema3b, Sema3c, Sema3d, Sema3e, Sema3f, Sema3g
Mouse Descriptions:
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A Gene [Source:
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3B Gene [Source:
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C Gene [Source:
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3D Gene [Source:
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3E Gene [Source:
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F Gene [Source:
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3G Gene [Source:

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa41220 Nonsense Mutation detected in F1 DNA Not yet available
sa2459 Nonsense F2 line generated Not yet available
sa45324 Splice Site, Nonsense Mutation detected in F1 DNA Not yet available
sa21304 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41220
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062515 Nonsense 207 749 6 17
Genomic Location (Zv9):
Chromosome 8 (position 26782966)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25910884
GRCz11 8 25930023
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATACTGCGTTTATTCGAAGTCTGGGGGAGCGACATGTGATTCGCACCGAA[C/T]AATACGACTCTACGTGGCTGCAAGGTGACACATGTGTAAATGTACACATT
Long Flanking Sequence:
AAAATAAATGAATTAAATTCAATTTAAAATTAATAAGTTACCTTGAGAATATGCAAACATACTGTAAATAAAGCTAAACATTGTAATATTGAAATAATAAAATAAATAAATAACTAAAGAATTAAACAAGCTTAAACTATTACAAAAACATGTAGAAATAAAATCATTTGAACAACTGAACAACCTTTTTTTTAGGCTGAGGAGCAAACACTGCAGGATGAAGACACTGAATCAGGGAGAGGAAAATGTCCTTTCGACCCTCACCAGAGAACAGCAACCGCCATCATAGGTGAGACGGCATGTTTACAGTTTGTCTGCAGTTTATATGTTTGTGTAAGAACATGCCAGTGTAACTCTGATCTAAATCTCTCTGTGTATGTGTGTCTGTTTTTTTTTCTTTTTCAGACGGAGAATTGTACGCAGGCATCTCATCTGACTTTCTAAGCCATGATACTGCGTTTATTCGAAGTCTGGGGGAGCGACATGTGATTCGCACCGAA[C/T]AATACGACTCTACGTGGCTGCAAGGTGACACATGTGTAAATGTACACATTCACCTCAGCTAACACTCTTAGCACTAATGAAAATACACACTGTATGTTGTTGACAGTGCGCTCTATCAGTTAAACACAAGGGAATGCAATCGCAAAAACAGATTCATGTGTTAGCTAACAGTATTTTTGTCTCTGCAGGCGCTGAATTTGTGCATGTTACAGCGATGTCAGAGAGTGATAACGAGGAGGATGATAAAGTCTACGTGTTCTTCACTGAGCGCGCTCAGGAAGCAGAAGGGGCTGCTGGGAAGGTCCTGTATTCCAGAGTGGCCCGCGTCTGTAAGGTATCTAGCAGTGTGCTCCTACGTGCCCGACTGCACTTGTGTGTCCCTCTGCCTGTTTGGCCACCTCTGCGAATCTGATAGGAAGTCCTGGGTGACATAACTATAAAATGTATTGCATGTATGAGTATATAATTATAATATTGTATGTAAATTATATATAAACATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2459
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062515 Nonsense 262 749 7 17
Genomic Location (Zv9):
Chromosome 8 (position 26783297)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25911215
GRCz11 8 25930354
KASP Assay ID:
554-3332.1 (used for ordering genotyping assays)
KASP Sequence:
GCAGAAGGGGCTGCTGGGAAGGTCCTGTATTCCAGAGTGGCCCGCGTCTG[T/A]AAGGTATCTAGCAGTGTKCTCCTACGTGCCCGACTGCACTTGTGTGTCCC
Long Flanking Sequence:
GTGTAAGAACATGCCAGTGTAACTCTGATCTAAATCTCTCTGTGTATGTGTGTCTGTTTTTTTTTCTTTTTCAGACGGAGAATTGTACGCAGGCATCTCATCTGACTTTCTAAGCCATGATACTGCGTTTATTCGAAGTCTGGGGGAGCGACATGTGATTCGCACCGAACAATACGACTCTACGTGGCTGCAAGGTGACACATGTGTAAATGTACACATTCACCTCAGCTAACACTCTTAGCACTAATGAAAATACACACTGTATGTTGTTGACAGTGCGCTCTATCAGTTAAACACAAGGGAATGCAATCGCAAAAACAGATTCATGTGTTAGCTAACAGTATTTTTGTCTCTGCAGGCGCTGAATTTGTGCATGTTACAGCGATGTCAGAGAGTGATAACGAGGAGGATGATAAAGTCTACGTGTTCTTCACTGAGCGCGCTCAGGAAGCAGAAGGGGCTGCTGGGAAGGTCCTGTATTCCAGAGTGGCCCGCGTCTG[T/A]AAGGTATCTAGCAGTGTGCTCCTACGTGCCCGACTGCACTTGTGTGTCCCTCTGCCTGTTTGGCCACCTCTGCGAATCTGATAGGAAGTCCTGGGTGACATAACTATAAAATGTATTGCATGTATGAGTATATAATTATAATATTGTATGTAAATTATATATAAACATAATTATATATGATAAAACCAAAAAATGTAGTAATAATTCTAAGAGTTTAAGCACACATTTTTTTTTTAAAATGAGAAATCATACTGTAATTTTGACTGTGAAGAATTATTAATAGTAGCATTACAAAAGTACCATAGTAGTATTGTGCTAAAGTGCTAATGCCATTGAACCGCTACACTGAAGAATGCTTTTCTTACTTTTGTCTTATTTCTTGTCCTAATATCTTAAACATTCTTAAATAAAGAAACATTTTCTAGACAAGTACACTCAAAAAATTATTCAAAGATACTTCCTTGGAATTACTTGTTTTTAAGAAAAGAGATTGTAAACAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8317
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062515 Nonsense 356 749 10 17
Genomic Location (Zv9):
Chromosome 8 (position 26793209)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25921127
GRCz11 8 25940266
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGGACATTATTAGAGCTTTTAAAGGAAACTTCCTTCACAGAGAGGGACAT[C/T]AGTACARGTTGACCGAGTACACAGGCAGAGTTCCCTATCCCAGACCCGGC
Long Flanking Sequence:
CCAATCTCAGTTCAGTTTAATTCAGGTGACATTTTAACCCGCACCGATGAGTCTGTGCTTTTACTGCCTGACTGGCTTCACACTTGAACTGAAGTGCCACTTTTAATTGTGCCACCAGAGCTGGGTTTTAATTGGATTTAAGGCAGGGTAAAGAGGATTGAATGTTAGTTGCTAGCTGGTGCTGTCTATGTAAAGAGTTCAGCTAAAAAAATCTTAAATGAGCTTTTTTCTTGGGCTCCTATGTGTAGGTTCAGTCGTTTTACTTTTTATGGCAAATAATAGGTTGTTTTCATTGCTTTTAACATGAAATAACTGAAGATAAACATTAGAGGTTGGTACATCTAAACTATTTATTTATAACTTTCAGTGCATTAATAGTTCATGTGTCTTTGGTTTCTTGTCTCGCCAGCAATGTGTTGAACGGATCTGCTGTGTGCGTTTACCGCATGCAGGACATTATTAGAGCTTTTAAAGGAAACTTCCTTCACAGAGAGGGACAT[C/T]AGTACAAGTTGACCGAGTACACAGGCAGAGTTCCCTATCCCAGACCCGGCACAGTGAGTGTATTTACATACCGTAAACCCATTTTTAAAATATGTATTCTGTTTAAACTTTGATACTTTGTTCATGTAAAATTAGATTAAAACACACACTAAATCAGAATCATTTAAAATTCATTGAATTAATTTTGATATAACATTAGGTTGCATTTACAGTAACTTACTGTTGGTATCTTTAGGATTATGATGAAAAAAATTATTACCATAAAGCGAAAATTTCATTTATGCATACAATATATTTCTTCTTTCCTTGGCCGCATAATTGTTCAATAAAATGTATGCATGGCTTCTGTAGTCAGAATGCCTAAAACCAACATAGTTTCATTCTGAAAACGCAGCCATGAATGCTACAGAGCGTTATGATGCCGTTTCTTTTTGCGCTTACGAGCTGACCACTTACCTCCATATGGACGGCTTTCCCGCTGTTAGCTTGTCCAGTTAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45324
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062515 Splice Site, Nonsense 374 749 11 17
Genomic Location (Zv9):
Chromosome 8 (position 26795379)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25923297
GRCz11 8 25942436
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGAAGGTTTATAGAGCACACTGCTGAAGTGTGTGTGTCAATGTTCAGTG[T/A]CCCAGCAGCACATACGGAGGCTTCAGATCCACAAGGGAATATCCAGATGA
Long Flanking Sequence:
ATTAACATTAACTAATGAACCTTATTGTAAAGTGTGACCAAATATACTAAAGTATAAAATGTAGCAAAATGTACTGTCTTGCCATTCTTTTAGATATTTAAATAAGTACAGAATAAGTATGTTATATTATTTTGAAAAAGTACAGTATATCTGTGATGCTGAAGGATAGTGGATCAATAATTCACTTTTATTTTTACAAAAAAGTATTTAAAATATTACGGAAACATTACTTAAATTGCAAATCAAGTCAAGTTCAACTTTATTGTCATTTTACTACATGTGACTACATACAGTGGTGCCACATACTGTAAATAAAAAGGACAAATATGAACACAACTGGATGTAAGAGCTTTTCTAAATTTTATACATCTATTATAAATAACTAAATTCATATCCTTTGACACTTCTACTTTATTCCAGTGTTTACAATATTTGAATTGAACTAAAATACTGAAGGTTTATAGAGCACACTGCTGAAGTGTGTGTGTCAATGTTCAGTG[T/A]CCCAGCAGCACATACGGAGGCTTCAGATCCACAAGGGAATATCCAGATGACGTGATCTTCTTCAGCCGCACACATCCGCTGATGCAGGAGGTGGTTCGTCCTCTCGGTGGTCAGCCTTTGCTGATCAGAGTGGGCGTCCCTTATAAACTCACCCGTCTGCTTGTGGACAGAGTCGAGGCCGTAGATGGACAGCATGACGTGATGTTCATTGGCACAGGTATGTGTTTGTGCGGTAACAGGGCGGAACAAGCCTAAAACAGCGTAGCTGCCCTAGACTAGCAATATTGGGGATTACCAAAATTATTTTGACAAAAATGTTTCTGTAATAGTTCATTTACCAAGGGTAAGCATAACTATAAGTGCCACAATAATATTTCTAATGCTTTCATCTGTGTTTCCTGTGTAAATATTTAAAAAAAATAATTAATATAATAACTTAATTTTTTATTCACTTAACCAGTTATACATTTCACTACATATAGTACAAATAAATTGTAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21304
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062515 Nonsense 388 749 11 17
Genomic Location (Zv9):
Chromosome 8 (position 26795421)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25923339
GRCz11 8 25942478
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTCAGTGTCCCAGCAGCACATACGGAGGCTTCAGATCCACAAGGGAATA[T/A]CCAGATGACGTGATCTTCTTCAGCCGCACACATCCGCTGATGCAGGAGGT
Long Flanking Sequence:
TATACTAAAGTATAAAATGTAGCAAAATGTACTGTCTTGCCATTCTTTTAGATATTTAAATAAGTACAGAATAAGTATGTTATATTATTTTGAAAAAGTACAGTATATCTGTGATGCTGAAGGATAGTGGATCAATAATTCACTTTTATTTTTACAAAAAAGTATTTAAAATATTACGGAAACATTACTTAAATTGCAAATCAAGTCAAGTTCAACTTTATTGTCATTTTACTACATGTGACTACATACAGTGGTGCCACATACTGTAAATAAAAAGGACAAATATGAACACAACTGGATGTAAGAGCTTTTCTAAATTTTATACATCTATTATAAATAACTAAATTCATATCCTTTGACACTTCTACTTTATTCCAGTGTTTACAATATTTGAATTGAACTAAAATACTGAAGGTTTATAGAGCACACTGCTGAAGTGTGTGTGTCAATGTTCAGTGTCCCAGCAGCACATACGGAGGCTTCAGATCCACAAGGGAATA[T/A]CCAGATGACGTGATCTTCTTCAGCCGCACACATCCGCTGATGCAGGAGGTGGTTCGTCCTCTCGGTGGTCAGCCTTTGCTGATCAGAGTGGGCGTCCCTTATAAACTCACCCGTCTGCTTGTGGACAGAGTCGAGGCCGTAGATGGACAGCATGACGTGATGTTCATTGGCACAGGTATGTGTTTGTGCGGTAACAGGGCGGAACAAGCCTAAAACAGCGTAGCTGCCCTAGACTAGCAATATTGGGGATTACCAAAATTATTTTGACAAAAATGTTTCTGTAATAGTTCATTTACCAAGGGTAAGCATAACTATAAGTGCCACAATAATATTTCTAATGCTTTCATCTGTGTTTCCTGTGTAAATATTTAAAAAAAATAATTAATATAATAACTTAATTTTTTATTCACTTAACCAGTTATACATTTCACTACATATAGTACAAATAAATTGTAATGTTTGTTTTTTTTTTTACTTGAGAGATGTTAAATGTGCCGGCT
Associated Phenotype:
Not determined