Busch Lab

ZMP

ICA1

Ensembl ID:
ENSDARG00000042608
Description:
islet cell autoantigen 1, 69kDa [Source:HGNC Symbol;Acc:5343]
Human Orthologue:
ICA1
Human Description:
islet cell autoantigen 1, 69kDa [Source:HGNC Symbol;Acc:5343]
Mouse Orthologue:
Ica1
Mouse Description:
islet cell autoantigen 1 Gene [Source:MGI Symbol;Acc:MGI:96391]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa15857 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15857
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062507 Essential Splice Site 232 450 6 19
Genomic Location (Zv9):
Chromosome 16 (position 50428971)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 47294547
GRCz11 16 47217567
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGGGAGCCAGTCGCTGTAATCTGCTCTCACACGTCCTGACAACCTATCAG[G/A]TGACTACCTATTCCTGCAGTTCARTTCTTATTAATATTGATGAAATTATT
Associated Phenotype:
Not determined