Busch Lab

ZMP

map3k12

Ensembl ID:
ENSDARG00000042565
ZFIN ID:
ZDB-GENE-040426-2436
Description:
mitogen-activated protein kinase kinase kinase 12 [Source:RefSeq peptide;Acc:NP_996977]
Human Orthologue:
MAP3K12
Human Description:
mitogen-activated protein kinase kinase kinase 12 [Source:HGNC Symbol;Acc:6851]
Mouse Orthologue:
Map3k12
Mouse Description:
mitogen-activated protein kinase kinase kinase 12 Gene [Source:MGI Symbol;Acc:MGI:1346881]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa38717 Nonsense Mutation detected in F1 DNA Not yet available
sa34533 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8327
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062432 Nonsense 211 856 4 15
Genomic Location (Zv9):
Chromosome 9 (position 257194)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 227316
GRCz11 9 226949
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTGTGTGTGTGTGTNNNNNNNNNNTTCAGGGGTGTGTGTACACAGGCTCCGTGTTAYTG[C/A]ATCCTCATGGAGTACTGTGCGCAGGGTCAGYTGTATGAGGTGCTGCGTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38717
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062432 Nonsense 217 856 4 15
Genomic Location (Zv9):
Chromosome 9 (position 257176)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 227334
GRCz11 9 226967
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGGGTGTGTGTACACAGGCTCCGTGTTACTGCATCCTCATGGAGTACTG[T/A]GCGCAGGGTCAGCTGTATGAGGTGCTGCGTGCGGGCCGGAAGATCACGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34533
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062432 Nonsense 300 856 5 15
Genomic Location (Zv9):
Chromosome 9 (position 256019)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 228491
GRCz11 9 228124
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGCTCAGGGATAAAAGCACCAAGATGTCGTTCGCTGGCACCGTGGCCTG[G/A]ATGGCACCGGAGGTGATACGGAACGAACCTGTGTCTGAGAAAGTGGACAT
Associated Phenotype:
Not determined