Busch Lab

ZMP

sema3ga

Ensembl ID:
ENSDARG00000042545
ZFIN ID:
ZDB-GENE-050513-3
Description:
semaphorin 3ga [Source:RefSeq peptide;Acc:NP_001014823]
Human Orthologue:
SEMA3F
Human Description:
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F [Source:HGNC
Mouse Orthologue:
Sema3f
Mouse Description:
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F Gene [Source:

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa31657 Essential Splice Site Available for shipment Available now
sa21302 Nonsense Available for shipment Available now
sa38690 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa18643 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa31657
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033701 None None 749 1 17
ENSDART00000143938 Essential Splice Site None 749 2 18

The following transcripts of ENSDARG00000042545 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 26543837)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25671755
GRCz11 8 25690894
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTAAGTCTACCTTGTTTTATTTTTCTTTCTTTTGTGTGGGTTTTTACA[G/A]GTTGCCTGCGAATGGCTGGAACTATGAGAGTTATGGAAACGCGACTCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21302
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033701 Nonsense 59 749 2 17
ENSDART00000143938 Nonsense 59 749 3 18

The following transcripts of ENSDARG00000042545 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 26518666)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25646584
GRCz11 8 25665723
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACACTCGGACAGCGAGGCCGTTCAGTTTTTCCTTCAACACCAGTGACTA[T/A]CGGATTCTGCATGTTGATCCAGACCAAGGCCGGTTGTACCTGGGCAGCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38690
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033701 Essential Splice Site 115 749 4 17
ENSDART00000143938 Essential Splice Site 115 749 5 18

The following transcripts of ENSDARG00000042545 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 26517885)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25645803
GRCz11 8 25664942
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCTCAGTTCAACAGTGGTTTGTTTGTTTGTGTGCATGTGTGTGTTTTTC[A/T]GGGAGAGTGTGCTAACTTTGTGCGCTTGATTGAGCCGTGGAACAGGACCC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27212
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033701 Essential Splice Site 336 749 9 17
ENSDART00000143938 Essential Splice Site 336 749 10 18

The following transcripts of ENSDARG00000042545 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 26513468)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25641386
GRCz11 8 25660525
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCCAGGATGAACGAAACCCTATTGTATATGGTGTCTTCTCCACTTCTGG[G/T]TACACTTTCCTTTATACATTTTCTTTATGTGAAATTGTAGTCATTTATGG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27211
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033701 Essential Splice Site 336 749 9 17
ENSDART00000143938 Essential Splice Site 336 749 10 18

The following transcripts of ENSDARG00000042545 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 26513467)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25641385
GRCz11 8 25660524
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCCAGGATGAACGAAACCCTATTGTATATGGTGTCTTCTCCACTTCTGGG[T/C]ACACTTTCCTTTATACATTTTCTTTATGTGAAATTGTAGTCATTTATGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18643
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033701 Essential Splice Site 459 749 12 17
ENSDART00000143938 Essential Splice Site 459 749 13 18

The following transcripts of ENSDARG00000042545 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 26510239)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25638157
GRCz11 8 25657296
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGGACWAATGCWGTGTAGATTTCAACTGTTTGTCTTTTCTGCCACCCTAC[A/T]GATCGTGGGACAGTCCAGAAAGTTATAGTTCTACCTAAGGATCCCAYAAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27210
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033701 Essential Splice Site 488 749 12 17
ENSDART00000143938 Essential Splice Site 488 749 13 18

The following transcripts of ENSDARG00000042545 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 26510147)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25638065
GRCz11 8 25657204
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCCACAACAATGGAAGAGCTCACTTTGGAGGAAGTAGAAGTTTTCAGGG[T/C]AAATTATATTACTGAAACCTTTTGTATACCTCATTATGTTACCCTCAGTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27209
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033701 Nonsense 617 749 16 17
ENSDART00000143938 Nonsense 617 749 17 18

The following transcripts of ENSDARG00000042545 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 26506486)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25634404
GRCz11 8 25653543
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCCCAGATCTCCTCAGGCCACCATCAAATGGCTCTACCAGAAAGAGGGA[C/T]GACGGAAAGTGGTATGATTTACAGTACATGCTGATGTCAAATCACCAACC
Associated Phenotype:
Not determined