Busch Lab

ZMP

si:dkey-251i10.3

Ensembl ID:
ENSDARG00000042520
ZFIN ID:
ZDB-GENE-060526-271
Description:
Novel protein similar to vertebrate UTP14, U3 small nucleolar ribonucleoprotein, homolog A (Yeast) (
Human Orthologues:
AL139082.1, UTP14A, UTP14C
Human Descriptions:
U3 small nucleolar RNA-associated protein 14 homolog C [Source:UniProtKB/Swiss-Prot;Acc:Q5TAP6]
UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeast) [Source:HGNC Symbol;Acc:10665]
UTP14, U3 small nucleolar ribonucleoprotein, homolog C (yeast) [Source:HGNC Symbol;Acc:20321]
Mouse Orthologues:
Utp14a, Utp14b
Mouse Descriptions:
UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeast) Gene [Source:MGI Symbol;Acc:MGI:19198
UTP14, U3 small nucleolar ribonucleoprotein, homolog B (yeast) Gene [Source:MGI Symbol;Acc:MGI:24450

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa40599 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa20585 Nonsense Available for shipment Available now
sa20584 Essential Splice Site Available for shipment Available now
sa20583 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa40599
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062349 Essential Splice Site 181 722 5 17
ENSDART00000125525 Essential Splice Site 191 260 6 8
ENSDART00000128050 Essential Splice Site 191 785 6 15
Genomic Location (Zv9):
Chromosome 5 (position 70488373)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 66813517
GRCz11 5 67491886
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGAGCCATCGGGTCCTAAACGGGTGGAGCAGGTCGTGGCTGGATGGAAGG[T/G]TATTTAATTGTTTGTAATTAAAATGTTTTGTGTATGTGTTTGTTTATTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20585
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062349 Nonsense 183 722 6 17
ENSDART00000125525 Nonsense 193 260 7 8
ENSDART00000128050 Nonsense 193 785 7 15
Genomic Location (Zv9):
Chromosome 5 (position 70486088)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 66811232
GRCz11 5 67489601
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACTTGATGTTGTTTTTATGATTAACTGTGTGTGTGTGTTCTGGCAGGTT[A/T]AAACTCCTCTTGAACAAGAGATTTTCCAACTCCTGCACAGCAACAGCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20584
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062349 Essential Splice Site 222 722 None 17
ENSDART00000125525 Essential Splice Site 232 260 None 8
ENSDART00000128050 Essential Splice Site 232 785 None 15
Genomic Location (Zv9):
Chromosome 5 (position 70484546)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 66809690
GRCz11 5 67488059
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGCTCCATATTTTCTTCTGCTACAGCTTATAACACCGTTTTATTATTGC[A/T]GGCTAAGATTCGTCGTGCTGAGCTTCAAAAGGCAAGAGCGCTCCAGTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20583
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062349 Nonsense 317 722 9 17
ENSDART00000125525 None None 260 None 8
ENSDART00000128050 Nonsense 327 785 10 15
Genomic Location (Zv9):
Chromosome 5 (position 70483127)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 66808271
GRCz11 5 67486640
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATCAGAACAGCGGGAAGTGGGCCAAATCAAAGGCCATCATGGCCAAATA[T/G]GACGACTCAGTGAGAATTTGATACTTTTTTTCTTCTTCATGCTTTTAATC
Associated Phenotype:
Not determined