Busch Lab

ZMP

rab40b

Ensembl ID:
ENSDARG00000042410
ZFIN ID:
ZDB-GENE-040718-257
Description:
ras-related protein Rab-40B [Source:RefSeq peptide;Acc:NP_001002524]
Human Orthologues:
RAB40A, RAB40AL, RAB40B
Human Descriptions:
RAB40A, member RAS oncogene family [Source:HGNC Symbol;Acc:18283]
RAB40A, member RAS oncogene family-like [Source:HGNC Symbol;Acc:25410]
RAB40B, member RAS oncogene family [Source:HGNC Symbol;Acc:18284]
Mouse Orthologue:
Rab40b
Mouse Description:
Rab40b, member RAS oncogene family Gene [Source:MGI Symbol;Acc:MGI:2183451]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa12834 Nonsense Available for shipment Available now
sa24917 Nonsense Mutation detected in F1 DNA Not yet available
sa42066 Nonsense Mutation detected in F1 DNA Not yet available
sa9095 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa12834
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062185 Nonsense 51 279 2 6
ENSDART00000140685 Nonsense 51 203 3 7
Genomic Location (Zv9):
Chromosome 12 (position 33738583)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 31936580
GRCz11 12 32051482
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AATGAGCATTTAAGTMATTTTATTTCATTTTAAATTGCAGGAATYGACTA[C/A]AAGACTACTACCATTCTCCTGGATGGACGCAGGGTTAAGCTTCAACTKTG
Long Flanking Sequence:
CGGCATCATAATTTACTCAAGTGCAAGGCACGCCTCAATGTCTTGCGCCCCATTTAATTGGGGCCTGGTGGGGCGCGCCCCACAGTTTGAAAACCCCTGGTCTAAAGCAGGGGTGCCCAAACTCAGAGCTGGAGGGCCAGTGTCCAGCGTATTTTAGTTCCGACCCCAATGAAACACACCTGAATCAGCTTTTCAAGCTCCTAGGTATACTAAAACTTCCACGCAAGTGTGTTGAAGGAAGTTGGATGCTAAACAATGCAGGACACCGGCCCTCCAGGACCGAGTTTGGACACCCCTGGTCTAGAGCATGCTTCTTAAGCTGAACATTTTTAAACGTTTGGACTATAAACAAGAGAACTTTTAGTAAGTAAAGCATTTTTTTGCAGTGTACCTAAACAAACCGAACTACGGGACAAATGCAATGCACATGGTTCTAAAACAAATGCTTTAAATGAGCATTTAAGTCATTTTATTTCATTTTAAATTGCAGGAATCGACTA[C/A]AAGACTACTACCATTCTCCTGGATGGACGCAGGGTTAAGCTTCAACTGTGGTGAGTCGCCTCCTACAGATACTGTACATGTTGATCATTTATGTTTGGCTTCATTTCTTTCTGTTATCATCTTCTTAAACTGCAACCAAGCATGAAGCAAGATTAAAGATCGCCCTCTTTAATCGCCAATAAAGTCCTGTTTTTTCTTCCTCAAAAAATTACACAAACATGCCAAACGTCTAGCTGTGTTAATTATAGCACTTCTCACTAAACTCCTCCACTGAAAAAATCAGCCAAGTCAGTCCCACTAGCCATATCTAGGAGTTGTTTAAATGTTTGGCTGTTTTTATTTATTTATCAAAGATGCAGTAGGAGATCTGAGAAAATGCTAACTTTAGCACTAGCATTGAAAACATACATCCTTTCCTGCCGTCCTAAAGTCATGAACACACACTAAATAGATGAACATAGACAACCTTATAACACTAGATCATGCCATTCAACAGTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24917
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062185 Nonsense 52 279 2 6
ENSDART00000140685 Nonsense 52 203 3 7
Genomic Location (Zv9):
Chromosome 12 (position 33738582)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 31936579
GRCz11 12 32051481
KASP Assay ID:
554-7613.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGAGCATTTAAGTCATTTTATTTCATTTTAAATTGCAGGAATCGACTAC[A/T]AGACTACTACCATTCTCCTGGATGGACGCAGGGTTAAGCTTCAACTGTGG
Long Flanking Sequence:
GGCATCATAATTTACTCAAGTGCAAGGCACGCCTCAATGTCTTGCGCCCCATTTAATTGGGGCCTGGTGGGGCGCGCCCCACAGTTTGAAAACCCCTGGTCTAAAGCAGGGGTGCCCAAACTCAGAGCTGGAGGGCCAGTGTCCAGCGTATTTTAGTTCCGACCCCAATGAAACACACCTGAATCAGCTTTTCAAGCTCCTAGGTATACTAAAACTTCCACGCAAGTGTGTTGAAGGAAGTTGGATGCTAAACAATGCAGGACACCGGCCCTCCAGGACCGAGTTTGGACACCCCTGGTCTAGAGCATGCTTCTTAAGCTGAACATTTTTAAACGTTTGGACTATAAACAAGAGAACTTTTAGTAAGTAAAGCATTTTTTTGCAGTGTACCTAAACAAACCGAACTACGGGACAAATGCAATGCACATGGTTCTAAAACAAATGCTTTAAATGAGCATTTAAGTCATTTTATTTCATTTTAAATTGCAGGAATCGACTAC[A/T]AGACTACTACCATTCTCCTGGATGGACGCAGGGTTAAGCTTCAACTGTGGTGAGTCGCCTCCTACAGATACTGTACATGTTGATCATTTATGTTTGGCTTCATTTCTTTCTGTTATCATCTTCTTAAACTGCAACCAAGCATGAAGCAAGATTAAAGATCGCCCTCTTTAATCGCCAATAAAGTCCTGTTTTTTCTTCCTCAAAAAATTACACAAACATGCCAAACGTCTAGCTGTGTTAATTATAGCACTTCTCACTAAACTCCTCCACTGAAAAAATCAGCCAAGTCAGTCCCACTAGCCATATCTAGGAGTTGTTTAAATGTTTGGCTGTTTTTATTTATTTATCAAAGATGCAGTAGGAGATCTGAGAAAATGCTAACTTTAGCACTAGCATTGAAAACATACATCCTTTCCTGCCGTCCTAAAGTCATGAACACACACTAAATAGATGAACATAGACAACCTTATAACACTAGATCATGCCATTCAACAGTGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42066
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062185 Nonsense 73 279 3 6
ENSDART00000140685 Nonsense 73 203 4 7
Genomic Location (Zv9):
Chromosome 12 (position 33735771)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 31933768
GRCz11 12 32048670
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAATCAATGTCTTCTTTGTTGTTTTTGTTTTGTAAAGGGACACCTCAGGA[C/T]AAGGCAGATTCTGTACCATATTCCGCTCCTATTCCAGAGGAGCACAGGTA
Long Flanking Sequence:
ATATTTTGAGAAAAGCTGGAAACCTGTAACTGTTGACTTCCATGGTATTTGTTTTTTTGTTTTTACTAAGGAAGTCAAAAGTATTTTCTTTTGTGTTCAACAGATTAAAGAAAGAATTGGTAGACTAAATAAATACTATAGTGAGTTAATTTAAATTTTTGAATGAACTATCCCTTTAAGAGTGCTTAGCTTTTTGCAAGCATCTGGAATCAACAATTGATATTCCGGCCTTGACAGACGAAGTGTTTTAGAGGGTTTGTGATACTCGAGTCGTTACCCGCCTCAATATGACTGGCACATCTTGGTGCTGCGCTCAGGCCTGGATGGTGAATGATTCATTTCACTGCTCCTACTCAAAGTCTGCAGCCCTGGCACCAACCACAGAGAGCTCCTCATGTCACCAGGCAGAGAGAAGGACAATGGCTACAGACGCACTGAAGAACAGACACTAAATCAATGTCTTCTTTGTTGTTTTTGTTTTGTAAAGGGACACCTCAGGA[C/T]AAGGCAGATTCTGTACCATATTCCGCTCCTATTCCAGAGGAGCACAGGTATGGTAAAAGTGATAAAAAGACTTTGGGGAAATATGAGTTTATCTGTTTTGTGTTTGTTCCAATTATAACGTTAAATATATACAACAACAACAATTGTTAAAATCCAAGCTTTAAATGAAAATTAATTGAAAAGGACATTAATAAAATGATCTATTATGGGTTATTTTGTAAATAATTAAAACAATACAAATTAATTTTTTTATTTCTAGTTATTTTGGGAAAAATGGCAATTGAAATTGTACACCAGTCACAATTTATTTAATCAACAAGTTTATAAGTGGCTGTTTTAAATGTAATTTAAATTAAAACAATTGCTTTTTTTTTTCTTTATATAATTCATTTAAATTGCATTCAAATGTAAATAATGCAAATAAAATTTAAATGCAATTTGTTTAAAATTATTACATTTTTATAAAAATATTTAACTTCATTTTATCATGTTCATAATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9095
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062185 Nonsense 108 279 4 6
ENSDART00000140685 Nonsense 108 203 5 7
Genomic Location (Zv9):
Chromosome 12 (position 33734131)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 31932128
GRCz11 12 32047030
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTTGTTTATGACATCACWAACCGGTGGTCTTTCGACGGCATCGACAGATG[G/A]ATTAAAGAGATTGATGAGGWAAAATCAGGWCAATCAGATCCAAAATGACT
Long Flanking Sequence:
AACCATTTGTGAAGCTGTGAGCATTTGTTTGCCCATTGCACATAATGTGCAAAGAGACTTTGGGAAACGGGCTTTTGAATATCTCTGAAATCCCAGACAGTAGTTAAACACCCCACCCAGAGATCAGCAGTTCCTGTTGAAAGTGTGCTATGCTATAAATTGGAGTGGACTGGTATTGTTGATATGACATTTCCTTGTTCTGGCAAACACAGATATCCTAATGACAGCAACTCCTGGAGCAAAGCCACATACTTTATTGACACTGCATCGTAAACATCTCTGCCAACACATTTACTCCCATACTGACTGAGATGATGAATAATACAACTCCCAGTACCACACTTTGAAAATTTTTTGCTATAGTCTGAAATTTTTAGGATAAATCTGTGTCTTATTTCATTCAAAACCTTTCATTCAAGTTTAATAATCTTTTTTTCACAGGGAGTCATCCTTGTTTATGACATCACAAACCGGTGGTCTTTCGACGGCATCGACAGATG[G/A]ATTAAAGAGATTGATGAGGTAAAATCAGGTCAATCAGATCCAAAATGACTGTAATTACAGTAATCAGCATGGTAATTGTGCAGTGCTGTGTGATTATGGGTATAAACAAACATGACATCATACTAGTGGCTTTGCAATTACATTAAAAATCTGAATAAAACATAAGCTAATCAGCTTAAGAAGTTCCTAAGATAGATGTGTCTTCATACATAGTAAAAAGCTATTAGTTTGCTTTACTTAAAAAAAGCGAGTATACCCATTGCTTTTAAACAAATTATTTGACTTTACTTTAAAAAAATGTAGTAAAACCACTGACTTTAAAGCGATTAGTTGGCTTTACTTAAAGAAACTAAGTAAATCCACTGCCTTAAAATTATTGAGTAAATGAATTATGTGCACAATTTTAAAAAATTAAGTTACGTCAACTTAACCTTTTCAAGTTACAATAAACATACTTATTTTTTAAAGTAAGGTCAACTTGTTGCTTTTAAGGCAGCGTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3825
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062185 Essential Splice Site 114 279 4 6
ENSDART00000140685 Essential Splice Site 114 203 5 7
Genomic Location (Zv9):
Chromosome 12 (position 33734111)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 31932108
GRCz11 12 32047010
KASP Assay ID:
2260-5596.1 (used for ordering genotyping assays)
KASP Sequence:
CCGGTGGTCTTTCGACGGCATCGACAGATGGATTAAAGAGATTGATGAGG[T/A]AAAATCAGGWCAATCAGATCCAAAATGACTGTAATTACAGTAATCAGCAT
Long Flanking Sequence:
GCATTTGTTTGCCCATTGCACATAATGTGCAAAGAGACTTTGGGAAACGGGCTTTTGAATATCTCTGAAATCCCAGACAGTAGTTAAACACCCCACCCAGAGATCAGCAGTTCCTGTTGAAAGTGTGCTATGCTATAAATTGGAGTGGACTGGTATTGTTGATATGACATTTCCTTGTTCTGGCAAACACAGATATCCTAATGACAGCAACTCCTGGAGCAAAGCCACATACTTTATTGACACTGCATCGTAAACATCTCTGCCAACACATTTACTCCCATACTGACTGAGATGATGAATAATACAACTCCCAGTACCACACTTTGAAAATTTTTTGCTATAGTCTGAAATTTTTAGGATAAATCTGTGTCTTATTTCATTCAAAACCTTTCATTCAAGTTTAATAATCTTTTTTTCACAGGGAGTCATCCTTGTTTATGACATCACAAACCGGTGGTCTTTCGACGGCATCGACAGATGGATTAAAGAGATTGATGAGG[T/A]AAAATCAGGTCAATCAGATCCAAAATGACTGTAATTACAGTAATCAGCATGGTAATTGTGCAGTGCTGTGTGATTATGGGTATAAACAAACATGACATCATACTAGTGGCTTTGCAATTACATTAAAAATCTGAATAAAACATAAGCTAATCAGCTTAAGAAGTTCCTAAGATAGATGTGTCTTCATACATAGTAAAAAGCTATTAGTTTGCTTTACTTAAAAAAAGCGAGTATACCCATTGCTTTTAAACAAATTATTTGACTTTACTTTAAAAAAATGTAGTAAAACCACTGACTTTAAAGCGATTAGTTGGCTTTACTTAAAGAAACTAAGTAAATCCACTGCCTTAAAATTATTGAGTAAATGAATTATGTGCACAATTTTAAAAAATTAAGTTACGTCAACTTAACCTTTTCAAGTTACAATAAACATACTTATTTTTTAAAGTAAGGTCAACTTGTTGCTTTTAAGGCAGCGTGTTTACTGTCTTTTTAAAGTA
Associated Phenotype:
Not determined