Busch Lab

ZMP

zgc:77752

Ensembl ID:
ENSDARG00000042387
ZFIN ID:
ZDB-GENE-040426-1867
Description:
hypothetical protein LOC393862 [Source:RefSeq peptide;Acc:NP_957182]
Human Orthologue:
PTPDC1
Human Description:
protein tyrosine phosphatase domain containing 1 [Source:HGNC Symbol;Acc:30184]
Mouse Orthologue:
Ptpdc1
Mouse Description:
protein tyrosine phosphatase domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2145430]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa43040 Nonsense Mutation detected in F1 DNA Not yet available
sa43041 Nonsense Mutation detected in F1 DNA Not yet available
sa45628 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa13631 Essential Splice Site Available for shipment Available now
sa43042 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa43040
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062150 Nonsense 29 626 2 12
ENSDART00000130301 Nonsense 29 642 1 15

The following transcripts of ENSDARG00000042387 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 7059328)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 7637018
GRCz11 18 7595953
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCCAGGCCAGGGAGAGTCTGGTGAAGGCCGTGCCTCCCAAGATCATCTG[T/A]CTTCTGGCCTGCGGAGGGAGAGACTGCCGCTATGAGGGACCGGCGTGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43041
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062150 Nonsense 130 626 5 12
ENSDART00000130301 Nonsense 130 642 4 15

The following transcripts of ENSDARG00000042387 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 7064148)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 7641838
GRCz11 18 7600773
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAACAAAACTGAAACAGACTGTTTGTTTTCATCTTCCAGTTTTCTTCTA[T/A]AATTTTGGCATGTCTGATTTTGGCGTGTCGTCTCTGGAGGGGATGCTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45628
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062150 Essential Splice Site 173 626 None 12
ENSDART00000130301 Essential Splice Site 173 642 None 15

The following transcripts of ENSDARG00000042387 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 7064277)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 7641967
GRCz11 18 7600902
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGGAAGGGAAAGTGGCCGTTCACTGCCATGCTGGACTGGGCAGAACAGG[T/A]AAATTACAATTTACATTATTACTGTACTTTCAGTCTAAACATCCTAGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13631
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062150 Essential Splice Site 451 626 7 12
ENSDART00000130301 Essential Splice Site 431 642 6 15

The following transcripts of ENSDARG00000042387 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 7068221)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 7645911
GRCz11 18 7604846
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTACAACCAAAAAACCTCAAGCTTTCCAGAAGTTCGGCTCAAACATTGAG[G/A]TCAGTGTGAGGAAACYGGATCAAATGCCCCCTGTGWGTTAAATTTARYTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43042
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062150 None None 626 None 12
ENSDART00000130301 Nonsense 507 642 12 15

The following transcripts of ENSDARG00000042387 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 7070102)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 7647792
GRCz11 18 7606727
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATTAAAAGTGTGTATTTGTTGATTTTACTAGCCTATGTTTAAATATTTA[T/A]ACTGAACAAGGTAAAAACGATTAAGAAAATCATTATATTACAGTGTTCCC
Associated Phenotype:
Not determined