Busch Lab

ZMP

si:ch211-195m2.2

Ensembl ID:
ENSDARG00000042285
ZFIN ID:
ZDB-GENE-050208-424
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q1LY58]
Human Orthologue:
ATP8B3
Human Description:
ATPase, aminophospholipid transporter, class I, type 8B, member 3 [Source:HGNC Symbol;Acc:13535]
Mouse Orthologue:
Atp8b3
Mouse Description:
ATPase, class I, type 8B, member 3 Gene [Source:MGI Symbol;Acc:MGI:1914581]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa37500 Nonsense Available for shipment Available now
sa43824 Nonsense Mutation detected in F1 DNA Not yet available
sa12857 Essential Splice Site Available for shipment Available now
sa43823 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa43822 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa37500
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088890 Nonsense 319 1198 10 30
ENSDART00000137371 Nonsense 288 1033 9 24
Genomic Location (Zv9):
Chromosome 22 (position 20817871)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 20472547
GRCz11 22 20497525
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGATTTTCGAGTACAGGATTTCTCCGAATTATGATGTTGTCTCCATTGTA[C/T]AACGCGACTCGTCTCCTGCCTATCAGGGCTTCCTAACATTTTGGGGCTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43824
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088890 Nonsense 534 1198 15 30
ENSDART00000137371 Nonsense 489 1033 12 24
Genomic Location (Zv9):
Chromosome 22 (position 20814606)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 20469282
GRCz11 22 20494260
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGGACACGTGACACTCTCACCATCAGCGAGATGGGCCTCACTCGAAACTA[T/A]CAGCTCCTGGCCCTTCTAGACTTCACCAGCAAGAGAAGACGCATGTCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12857
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088890 None None 1198 None 30
ENSDART00000137371 Essential Splice Site 508 1033 13 24
Genomic Location (Zv9):
Chromosome 22 (position 20812711)
Other Location(s):
Assembly Chromosome Position
GRCz11 22 20492365
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTGTGTNGTGTGTGTNGTNGTNGTGTGTGTGTGTGTGTGTGTGTGTKTGTGTA[G/A]TGCGTAGCCCTGGAGGACAGTTAAAGCTGTACAGTAAGGGWGCAGATATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43823
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088890 Essential Splice Site 767 1198 22 30
ENSDART00000137371 None None 1033 None 24
Genomic Location (Zv9):
Chromosome 22 (position 20807388)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 20462064
GRCz11 22 20487042
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTAAGTTTTTTTTTTTTTTTTTTTAGAAATTATTACTTTAATTCAGCAAG[G/T]ATGGGGTTAGTTCACCCAAAATTTAAATTCTGTTATCAATTACTGATCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43822
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088890 Nonsense 1169 1198 30 30
ENSDART00000137371 None None 1033 None 24
Genomic Location (Zv9):
Chromosome 22 (position 20799856)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 20454532
GRCz11 22 20479510
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCAAGGGAAAGGTTTCGGAAAGTTAATTACCACAGGAGTTGGTCTTCCCT[C/A]AGCAGCGCCTCGACAGGATGGGAGAGTTACAGCAGAAAGCCTGAAGAATG
Associated Phenotype:
Not determined