Busch Lab

ZMP

efnb3b

Ensembl ID:
ENSDARG00000042277
ZFIN ID:
ZDB-GENE-010618-3
Description:
ephrin B3b [Source:RefSeq peptide;Acc:NP_571881]
Human Orthologue:
EFNB3
Human Description:
ephrin-B3 [Source:HGNC Symbol;Acc:3228]
Mouse Orthologue:
Efnb3
Mouse Description:
ephrin B3 Gene [Source:MGI Symbol;Acc:MGI:109196]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa40869 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa40869
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062003 Nonsense 205 342 5 5
Genomic Location (Zv9):
Chromosome 7 (position 22257117)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 20822312
GRCz11 7 21088650
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTATATCTGTTGAACTGATCAAAATCTTCTCTCTGTTTTCCAGGTACT[G/T]GAAACAGCACCCATCCGCAAATTCCCCCTAGAGGTTCTGGTGGTGAAAAC
Associated Phenotype:
Not determined