Busch Lab

ZMP

ppial

Ensembl ID:
ENSDARG00000042247
ZFIN ID:
ZDB-GENE-030131-7459
Description:
peptidylprolyl isomerase A, like [Source:RefSeq peptide;Acc:NP_956251]
Human Orthologues:
AC011483.1, AC013283.2, AC113554.1, PPIA, PPIAL4A, PPIAL4B, PPIAL4C, PPIAL4G, PPIF
Human Descriptions:
peptidylprolyl isomerase A (cyclophilin A) [Source:HGNC Symbol;Acc:9253]
peptidylprolyl isomerase A (cyclophilin A)-like 4A [Source:HGNC Symbol;Acc:24369]
peptidylprolyl isomerase A (cyclophilin A)-like 4B [Source:HGNC Symbol;Acc:33994]
peptidylprolyl isomerase A (cyclophilin A)-like 4C [Source:HGNC Symbol;Acc:33995]
peptidylprolyl isomerase A (cyclophilin A)-like 4G [Source:HGNC Symbol;Acc:33996]
peptidylprolyl isomerase F [Source:HGNC Symbol;Acc:9259]
Mouse Orthologues:
Gm10123, Gm5160, Gm9234, Ppia, Ppif
Mouse Descriptions:
peptidylprolyl isomerase A Gene [Source:MGI Symbol;Acc:MGI:97749]
peptidylprolyl isomerase F (cyclophilin F) Gene [Source:MGI Symbol;Acc:MGI:2145814]
predicted gene 5160 Pseudogene [Source:MGI Symbol;Acc:MGI:3648528]
predicted pseudogene 10123 Pseudogene [Source:MGI Symbol;Acc:MGI:3704342]
predicted pseudogene 9234 Pseudogene [Source:MGI Symbol;Acc:MGI:3648545]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa8587 Nonsense Mutation detected in F1 DNA Not yet available
sa41740 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa8587
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061958 Nonsense 93 164 4 5
Genomic Location (Zv9):
Chromosome 10 (position 46006575)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 45504501
GRCz11 10 45351113
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGTCCATCTACGGCAACAAGTTTGAGGATGAAAACTTCACACTGAAACAC[G/T]GAGGCAAAGGCAYCCTGTCTATGGCCAACGCCGGCCCCAACACCAACGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41740
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061958 Essential Splice Site 121 164 4 5
Genomic Location (Zv9):
Chromosome 10 (position 46006489)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 45504587
GRCz11 10 45351199
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCAACACCAACGGCTCGCAGTTCTTCATCTGCACCGCCGACACCAACTG[G/A]TAAAACACACACACACACACACACACACACACACACACTATAGAAGGAAA
Associated Phenotype:
Not determined