Busch Lab

ZMP

specc1lb

Ensembl ID:
ENSDARG00000042232
ZFIN ID:
ZDB-GENE-090423-1
Human Orthologue:
SPECC1L
Human Description:
sperm antigen with calponin homology and coiled-coil domains 1-like [Source:HGNC Symbol;Acc:29022]
Mouse Orthologue:
Specc1l
Mouse Description:
sperm antigen with calponin homology and coiled-coil domains 1-like Gene [Source:MGI Symbol;Acc:MGI:

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa43597 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa11703 Nonsense Available for shipment Available now
sa6665 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa43597
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061912 Essential Splice Site 97 1121 2 15
ENSDART00000142569 Essential Splice Site 97 1121 3 16
ENSDART00000146062 None None 106 None 3
Genomic Location (Zv9):
Chromosome 21 (position 11446890)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13148255
GRCz11 21 13245243
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCTCTCAGATCACCAGCAACACTGAGACAAGGTCCAAGACCACTTCAGG[T/C]AGTGTTAGGTATTGCCTTGGTTCTAGCATATTCAGCAGGAGGTTTTTTTG
Long Flanking Sequence:
AGCTTATTCGTCCAAATGATTTACCATCTGCTTTCATTTATATAGATTACGCTGTAAATGTATCAAGAACTTGGAACCAAGCATGAAAAAGGCGACCAAGCCCACGGCCGCCACCTCCAGGACCTCAGTGGGCACTAAAGCCCCAGGCAGATCAGAGGGAAGCAGCAATATGGGCACAGGAGGCAAGATGACAAACAAAACCCAGAGTTCAGCTCCACTTTCTAAGGTAGCAGTTTTACTCTGAGGAATCTGAAACGTTTGTTTTTAAGCATGTTGAACCAAGTGCCAGCTAAGACTGCTGGATTTAACTTGTCTGTTGCAGATCATTAACTTAATTTTTTGCTTGCTAACCAGGCAAAGAGCAGTGATGATCTCCCAGCGGTGAGTGCAGGAAGTGGATCTGTTTCTGCTAGCAACAGTAACACTACTGCTAGAAACAAGAGAGGATCCTCCTCTCAGATCACCAGCAACACTGAGACAAGGTCCAAGACCACTTCAGG[T/C]AGTGTTAGGTATTGCCTTGGTTCTAGCATATTCAGCAGGAGGTTTTTTTGATAATGAAATGTCTATAGTAGTTATACATTTATGGACACATTCTGCTTTTACAGGTCTTTCAGGAAGGCGTGCAACGTCAACTGTGTCTAAGGAGCCAGGCTTGACTAGAGATAACTTGCGAGAAAGATCCAGAACCAGTGTTGCCAAAAAACCCACCGATACCATGCCTCAAAAGCGTTCACGATGTCGTACCTTACCTGACTCTGAGTCAAAAATGAGCAAATCTCGCTCAGACAGCCAGATAAGCCATAAAGCAGTTCTTGAGTGTCAAGTGAATGACCTTCTTGGTTTAGCCAAGAGCAAAGACCTGGAAATCCTTCATCTTCGCTCTGAACTTCGAGGCATGAGAACTCAGCTTGGCTTGGAAGAACTTGAGGCTCCTAACCAAGAACAAGTGTCTCAAGAGACCATGCAGCCTCCAGAGAAAGAGGTTATCAGTGCCACAGATG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29541
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061912 Nonsense 276 1121 3 15
ENSDART00000142569 Nonsense 276 1121 4 16
ENSDART00000146062 None None 106 None 3
Genomic Location (Zv9):
Chromosome 21 (position 11447531)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13148896
GRCz11 21 13245884
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCGCCTTAATGCGCTCGGCTTTTCTCTGGAGCAACGTCTAGACAGCCCT[G/T]AGAAAAGTCTGCGCTGCCTGCCTATGAGTCCTGAGCATGTAGTTGGCGGC
Long Flanking Sequence:
AGGAGCCAGGCTTGACTAGAGATAACTTGCGAGAAAGATCCAGAACCAGTGTTGCCAAAAAACCCACCGATACCATGCCTCAAAAGCGTTCACGATGTCGTACCTTACCTGACTCTGAGTCAAAAATGAGCAAATCTCGCTCAGACAGCCAGATAAGCCATAAAGCAGTTCTTGAGTGTCAAGTGAATGACCTTCTTGGTTTAGCCAAGAGCAAAGACCTGGAAATCCTTCATCTTCGCTCTGAACTTCGAGGCATGAGAACTCAGCTTGGCTTGGAAGAACTTGAGGCTCCTAACCAAGAACAAGTGTCTCAAGAGACCATGCAGCCTCCAGAGAAAGAGGTTATCAGTGCCACAGATGTGGAGTCTACTCTCCTCCTCCTTCAAGACCAGAACCAGGGTATTCTTGATGAGTTAAATATGTTGAAGAGTGAAAACCGAATGCTGAAGGATCGCCTTAATGCGCTCGGCTTTTCTCTGGAGCAACGTCTAGACAGCCCT[G/T]AGAAAAGTCTGCGCTGCCTGCCTATGAGTCCTGAGCATGTAGTTGGCGGCGACAGCAGTAGCGGAGGTCACAGTGAAAGTGTACGGGGTGGTATGCGTGCATCCTCTGCAGAAGGCTCTGCTCAAGGCTCTACAGAGGACCTGCTGTCAGAACAGAGACATTTAGGCTCTCCTGATGCTGTGGACAGTGAGTGCAGTGAGGCCTACCAGCCGATCACTTCCAGCGATGATGCTCTAGATGCACCATCAGGTTGTGGATCATCTTCGGAATCAGAAGGTGGGCTGCCGAGCCGGGAACATTCCCGTAGAGGCAGCAGTGGGAACACCAGTGAGGTTTCTGTGGCCTGCTTGACTGAGCGAATCCATCAAATGGAGGAAAATCAACACAGCACGTCAGAAGAACTCCAGGCCACCCTGCAGGAGCTTGCAGATCTGCAGCAGATCACTCAAGAGCTGAGCACAGAGAATGAACGGCTGGGCGAGGAGCGTGCTATTCTGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11703
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061912 Nonsense 572 1121 3 15
ENSDART00000142569 Nonsense 572 1121 4 16
ENSDART00000146062 None None 106 None 3
Genomic Location (Zv9):
Chromosome 21 (position 11448419)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13149784
GRCz11 21 13246772
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCAAAGCAGAGTTAGARGCATTAAGGGTGCTGTCTGAAGGGGAGCAGGTG[G/T]AGCTGAACCGCTGTAGAATCCAACTTGAGCAAGAGAGGCAGAGAGTGGCC
Long Flanking Sequence:
GCACGTCAGAAGAACTCCAGGCCACCCTGCAGGAGCTTGCAGATCTGCAGCAGATCACTCAAGAGCTGAGCACAGAGAATGAACGGCTGGGCGAGGAGCGTGCTATTCTGGTGGACTCCCTCTGTCAGCAAGGGGAGCGTCTGGAGCTATATGGAAGACAACTGGAGTACTTTCGTGGACTTCTTGATGAGCATTGTGTGGCCTATGTCAAGGATGATGAAGACGCCAAAAGTGGGCGCTATGTAGAGCTGGAAAGGCGCTATGCCGAGCTGAATGAGGGCTCCCGTTTTGAACGGGAGCAACTTCTGGGAGTGCAGCAACAGCTAAGCAGTGCCCTAAAGATGGCAGAACATGAGAATGCAGAAGCCCAAGGCCTCATGGCAGCATTGAAAGAGCGTGTCATTATGGCAGAGAGAGCTGTGGAAATAGAGCGGCGGGAGCGAGCAGTTGCCAAAGCAGAGTTAGAAGCATTAAGGGTGCTGTCTGAAGGGGAGCAGGTG[G/T]AGCTGAACCGCTGTAGAATCCAACTTGAGCAAGAGAGGCAGAGAGTGGCCCAGCTCCTCTCCATCCACAATGCAGGGGATAAGACGGACATACGCCACCTGCTGGAAAGCGAGAGATTAGATAAAGAGCGAGCAGAGGCCAAAGCAGCTCAGTTAAAAGAAGAACTTGGGCACACACGCAGTGAAGCTGCCCAGCTCCAGGAGGCGATTAGCAAGGTGAAACATATTCAGAAAATGTATACCTTTGCTTGCCTTAAAGGAACTCTCTACGCTTTTTGGAAATAGGCCACTTTTACAAGTCACCCAGAGTTCAACAGTTGTCTTTAGCCATTTTTTAATCTATTCAGTTGGCGGCAACGATTTTAGCTTAGCATAGCGTAGATTATTAAATATGATTTTAAAAACTTTTAAATCTATAGTCAATCCAAACATTAATTCTGGAAACCAATTTCTATTGGGGTATTTATTTTTTGTTTTATTATTTTTGTATTGTTTTGTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6665
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061912 Essential Splice Site 1092 1121 14 15
ENSDART00000142569 Essential Splice Site 1092 1121 15 16
ENSDART00000146062 None None 106 None 3
Genomic Location (Zv9):
Chromosome 21 (position 11485464)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13186829
GRCz11 21 13283817
KASP Assay ID:
554-4492.1 (used for ordering genotyping assays)
KASP Sequence:
CACTTTAGCCTTCCAGGCAGCAGAAAGCGTTGGAATTAAATCAACACTGG[T/A]GAGTTGAGTTTAATATGATCATCACCACTATTTTACATATCCATTTGCTC
Long Flanking Sequence:
TTCCAGATGACTTTATTAATAAGTGATTTGAGTCATTGCAGAGATGTATGGATGCAGTCCTCCAAGCTCATGAGAGACATACACAGTATTAATTCTTTTTCCACTGCACCATGACTTTATATTTTTTACTGTACATTATTTCTGTTAAGTGACAAGACATTTGAGTAAGCAAAGTCAGACCTTAGTGTCCTAATTAAATAATAAAAAATCAAGGCATGATTATATTGTATTTTGGTAAAATAAGCGTAATCTAGAGGCCTTTGACTTTCATATAAGCCACTTCTGATGTCAAATGATCAACTAGTAGTCAAGTTATTATTTGTTATTCCTAAAAGACTTTTGTCAGGTAGTGTACATTTTGTTTTTCAGTACCAGTCATTACTAAACTGTCTTTTAGAGTGTTTACAAATTTCAGTTCATTCATTGATGTCTTTTGCAGAGGCGAAATTTCACTTTAGCCTTCCAGGCAGCAGAAAGCGTTGGAATTAAATCAACACTGG[T/A]GAGTTGAGTTTAATATGATCATCACCACTATTTTACATATCCATTTGCTCAACTTCCTTGAATTTTTTATATGTACAATGTTTTAGGAAGAAATTCAACATTTTATTTAGCAAGAATGGCTTAATTTTCTCATAAGTGACTGAAAAGATATTCTGATCAGGCTGTTTAAAGTATATCAAAGTAGTTTCCAATTATAATATTTCACAATACTACAGCTGTTCATATATATATATATATATGAACATGGTGAACATATTTGTAGATTCATTTTTATCAGATTAGACTTATTGAAATCTGTCATACACAACTTTTCTTTAGGATTTTCCTAGATTTTGTGTTTATAAATTGTGCTTTATCAGTTGTGAATTGTGATTGCCGTTGTATTTAATTGAATGATTTCATAAAGCTGTGTTTGCAGTAAATGGTGACTGCTTGCCATGTTATAAAAGCTGTTTTGTGTGCCCTTTGCTCAACAAGCTTTGCAAGATACTTCTGTAACA
Associated Phenotype:
Not determined