Busch Lab

ZMP

si:ch211-59c24.1

Ensembl ID:
ENSDARG00000042189
ZFIN ID:
ZDB-GENE-060503-607
Description:
hypothetical protein LOC567512 [Source:RefSeq peptide;Acc:NP_001038600]
Human Orthologue:
TSPAN33
Human Description:
tetraspanin 33 [Source:HGNC Symbol;Acc:28743]
Mouse Orthologue:
Tspan33
Mouse Description:
tetraspanin 33 Gene [Source:MGI Symbol;Acc:MGI:1919012]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa11114 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11114
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061848 Nonsense 4 266 1 8
ENSDART00000136751 None None 241 None 7
Genomic Location (Zv9):
Chromosome 18 (position 10443470)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 11026716
GRCz11 18 10995434
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATGTTTGTAATTAYATTTATGCTTCTTAAAAATCTGTTCAAATGGACAGG[C/T]AGGTGAGCCTAAGCAGGACRGAAATGTTCTCTTTCCTCAACCCTTGGATC
Associated Phenotype:
Not determined