Busch Lab

ZMP

zgc:110463

Ensembl ID:
ENSDARG00000042157
ZFIN ID:
ZDB-GENE-050522-70
Description:
peptidyl-prolyl cis-trans isomerase-like 6 [Source:RefSeq peptide;Acc:NP_001018433]
Human Orthologue:
PPIL6
Human Description:
peptidylprolyl isomerase (cyclophilin)-like 6 [Source:HGNC Symbol;Acc:21557]
Mouse Orthologue:
Ppil6
Mouse Description:
peptidylprolyl isomerase (cyclophilin)-like 6 Gene [Source:MGI Symbol;Acc:MGI:1920325]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa44945 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa44945
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061789 Essential Splice Site 142 293 4 8
ENSDART00000140361 Essential Splice Site 157 308 4 8
Genomic Location (Zv9):
Chromosome 20 (position 33764758)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 33837271
GRCz11 20 33740150
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATATGGACATTGAGAATGGTGGAGAGGCAGTTGGCAGACTGTTGTTTGAG[G/A]TAAGAAGAATATATTAATGAGAGAAATTGTTGTAGAGATAAATGTTGGGG
Associated Phenotype:
Not determined