Busch Lab

ZMP

rbbp5

Ensembl ID:
ENSDARG00000042147
ZFIN ID:
ZDB-GENE-040426-886
Description:
retinoblastoma-binding protein 5 [Source:RefSeq peptide;Acc:NP_956539]
Human Orthologue:
RBBP5
Human Description:
retinoblastoma binding protein 5 [Source:HGNC Symbol;Acc:9888]
Mouse Orthologue:
Rbbp5
Mouse Description:
retinoblastoma binding protein 5 Gene [Source:MGI Symbol;Acc:MGI:1918367]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa13180 Essential Splice Site Available for shipment Available now
sa24048 Nonsense Available for shipment Available now
sa45750 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa13180
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061775 Essential Splice Site 120 512 4 14
Genomic Location (Zv9):
Chromosome 22 (position 740033)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 743186
GRCz11 22 780909
KASP Assay ID:
2261-6190.1 (used for ordering genotyping assays)
KASP Sequence:
TCCGCTTTCCSTCCCCCATCCTCAAGCTGCAGTATCACCCCCGAGACATG[T/A]GAGTGMTGTCACTTTYTCTCGYACCCGTCAACCACCGCRRCGCACTTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24048
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061775 Nonsense 220 512 7 14
Genomic Location (Zv9):
Chromosome 22 (position 736935)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 740088
GRCz11 22 777811
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATGGTGTGTGTTGTGTGCCCCCAGTTGTTTCCTCATCAACACAGCAGAT[C/T]GAATCATTCGAGTTTACGACGGTCGAGAGATCCTGACCTGCGGCAGAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45750
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061775 Essential Splice Site 326 512 9 14
Genomic Location (Zv9):
Chromosome 22 (position 736161)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 739314
GRCz11 22 777037
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGCCTCCATCTCCAGCGGCGTGGTCTCCATATGGGCTCAGAACCAAGTGG[T/A]GAGAAAATCAAACAAATCAGACTGTAAAGTGTAACGTGTCACTGTAACGC
Associated Phenotype:
Not determined