Busch Lab

ZMP

si:ch211-260g14.4

Ensembl ID:
ENSDARG00000042138
ZFIN ID:
ZDB-GENE-041014-326
Description:
Novel protein similar to vertebrate selectin L (Lymphocyte adhesion molecule 1) (SELL) [Source:UniPr
Human Orthologues:
SELE, SELL, SELP
Human Descriptions:
selectin E [Source:HGNC Symbol;Acc:10718]
selectin L [Source:HGNC Symbol;Acc:10720]
selectin P (granule membrane protein 140kDa, antigen CD62) [Source:HGNC Symbol;Acc:10721]
Mouse Orthologues:
Sele, Sell, Selp
Mouse Descriptions:
selectin, endothelial cell Gene [Source:MGI Symbol;Acc:MGI:98278]
selectin, lymphocyte Gene [Source:MGI Symbol;Acc:MGI:98279]
selectin, platelet Gene [Source:MGI Symbol;Acc:MGI:98280]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa3047 Nonsense F2 line generated Not yet available
sa139 Nonsense Confirmed mutation in F2 line Not yet available
sa43485 Nonsense Mutation detected in F1 DNA Not yet available
sa39288 Nonsense Mutation detected in F1 DNA Not yet available
sa23751 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa3047
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061765 None None 417 None 7
ENSDART00000121567 Nonsense 65 212 1 3
ENSDART00000130538 None None 178 None 4
ENSDART00000133081 Nonsense 94 846 1 14

The following transcripts of ENSDARG00000042138 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 33984143)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34056656
GRCz11 20 33959535
KASP Assay ID:
554-2513.1 (used for ordering genotyping assays)
KASP Sequence:
GCAAACTGGGCGACAAATGAACCGAATAACCAGGGGACTGGAGAAGACTG[T/A]GTGGAGATTTACATCAAGAGGAACAAAGACACTGCCAAGTGGAACGACGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa139
Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061765 None None 417 None 7
ENSDART00000121567 Nonsense 141 212 3 3
ENSDART00000130538 None None 178 None 4
ENSDART00000133081 Nonsense 167 846 3 14

The following transcripts of ENSDARG00000042138 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 33982190)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34054703
GRCz11 20 33957582
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGACCATTTACACTATTGCAGTTGTCCAGTGCCAGCCAGTTGAAAACCCA[C/T]AGCAAGGTCTTGTGAAGTGTGACGGCGCCTTTGGAGAGTTTAACTTTAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43485
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061765 None None 417 None 7
ENSDART00000121567 Nonsense 204 212 3 3
ENSDART00000130538 None None 178 None 4
ENSDART00000133081 None None 846 None 14

The following transcripts of ENSDARG00000042138 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 33981999)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34054512
GRCz11 20 33957391
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTCCTGTTTGTCAGGGTATGGACCATACTGGGTTGCTATGCATAAATTG[T/A]ACTTCACAGCTTAAAAATCATTGTTGATTCACATAACATTCATGGAAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39288
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061765 None None 417 None 7
ENSDART00000121567 None None 212 None 3
ENSDART00000130538 None None 178 None 4
ENSDART00000133081 Nonsense 232 846 4 14

The following transcripts of ENSDARG00000042138 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 33981606)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34054119
GRCz11 20 33956998
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCATTACAGCTGTCAAATGTCAGGCAATCATTGATGCCCCTCGTGGTTG[G/A]ACAATGATCTGCACTCATCCGCTTTCCATGAATAGCTTCAACTCCAGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23751
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061765 Essential Splice Site 173 417 3 7
ENSDART00000121567 None None 212 None 3
ENSDART00000130538 None None 178 None 4
ENSDART00000133081 Essential Splice Site 406 846 6 14

The following transcripts of ENSDARG00000042138 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 33979655)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34052168
GRCz11 20 33955047
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACTGCACCAAACAGGGGAACTGGAGTCATATATCACCTATTTGTCATGG[T/A]ATCGTTCATTATTCACTGTACTAAGATATCTTCAGTTACTGTAAGTTCAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4128
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061765 Nonsense 199 417 4 7
ENSDART00000121567 None None 212 None 3
ENSDART00000130538 None None 178 None 4
ENSDART00000133081 Nonsense 432 846 7 14

The following transcripts of ENSDARG00000042138 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 33979484)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34051997
GRCz11 20 33954876
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCAAAATATGGAAGTGTGAGCTGTGTACACCCCCTGTCTACCAATAGCTA[C/A]AACTCCAGCTGTGAGTTTAAGTGTGAGGAGGGTTTGGTGCTCAGAGGCAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4916
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061765 None None 417 None 7
ENSDART00000121567 None None 212 None 3
ENSDART00000130538 None None 178 None 4
ENSDART00000133081 Nonsense 665 846 11 14

The following transcripts of ENSDARG00000042138 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 33976647)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 34049160
GRCz11 20 33952039
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATGTTATTATTNNTTTTNNACATAGCTCAAGAGTGCCCTCTTTTGAGCGCTCCA[G/T]AAAATGGCTGGATGAATTGCTCTCAWCCTCACTCTNNGTTTAGCTATGAA
Associated Phenotype:
Not determined