Busch Lab

ZMP

im:7143453

Ensembl ID:
ENSDARG00000042126
ZFIN ID:
ZDB-GENE-050309-39
Description:
Im:7143453 protein [Source:UniProtKB/TrEMBL;Acc:Q5CZM5]
Human Orthologue:
ELMO3
Human Description:
engulfment and cell motility 3 [Source:HGNC Symbol;Acc:17289]
Mouse Orthologue:
Elmo3
Mouse Description:
engulfment and cell motility 3, ced-12 homolog (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:2679007]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa32524 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4322
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061738 Nonsense 359 715 12 20
Genomic Location (Zv9):
Chromosome 25 (position 17812479)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 17357587
GRCz11 25 17453987
KASP Assay ID:
2261-9556.1 (used for ordering genotyping assays)
KASP Sequence:
TTTGTTTTTTGTCAGAATAACAGTAATCCTGGTCAGGATCTGAGCCGGTG[T/A]CCTCCAGGTCTACTRGCGTTGGACACAATGGCATATTTTGCCTCCCGTTA
Long Flanking Sequence:
GAAGCAGAAGAGGAACAAAGCTTTTTTATTATTTTAATTATTTTTTAATCATTTATTTATTACTTTTATTTCTAGTTATTTTTGTTATTTATTTTTTTTATAAATTTCTTTTTACATTTATTGTGTAATTTAATACCTATATTGTTTTTATGGTCATTGGTTCTTAGTTGTGAAAAAGCAGAATAGTGTAGTACTTTTGTATGTATATGATATTGTATCTGCACAAAATGTTCATAACTGTTAATGTTCATAACAATAAATGTTCTTTTTTTTTTGGCAAAAAGTGTTTTCAAATAATACAAATTTCAGTGGGGGACTAATTTTTTTTCCCCACTGTATATACTGTATAAAGTTTAAATATTATATTTTAAATGTCACATGCACAGTTGCTTTGTTAATTTCTAATGCACCAAGTTAACCATCAAGTCTTATTTTGGTTAAGGCTCTATGTTTGTTTTTTGTCAGAATAACAGTAATCCTGGTCAGGATCTGAGCCGGTG[T/A]CCTCCAGGTCTACTAGCGTTGGACACAATGGCATATTTTGCCTCCCGTTATCCTGACGCATACAGCCGGGTGAGTGAGAGTTTCTATAAATATATTCATTTTTGAGGCAAGTACACATCAGTCTGCACAGAGCCTTCATAGTCTGTGTGTCCTTGTGTCAGTTTGTGCTGGAGAACAGCAGCAGAGAAGACAAACATGAGTGTCCGTTCGCCCGCAGCAGCATCCAGCTCACACTCATCCTGTGCGAGATCTTGCGCATCGGAGAACCTCGTAAGTGACACATGTTGGAGATGGTGACAATGATCAGATCAAGGCTTTACTGTTTGTGTGTGTGAATATGTGGTTTATATATATTTTAACACTGTTAAAAAAATGCTTACAGTATTGTTGCCTTACCCTACACTTAAAGGGATAGTTCACCTAAAAATAAAAATGTACTCACTATTTACTCACACACAAGTGGTTCCAAAGCTTTGTAAGTTTCTTTGTCAGTTGAAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32524
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061738 Essential Splice Site 557 715 17 20
Genomic Location (Zv9):
Chromosome 25 (position 17827947)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 17371811
GRCz11 25 17468211
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGCAATGCTAAAGAAACCACATTAGCAATTATTGTGTGGTTGTGTTTCC[A/G]GACAAGCTGTGGTACTGTCGACTCTCTCCTAACCATAAAGTGCTGCACTA
Long Flanking Sequence:
CGCAAAATACACACTAATGCTAACATAACCATTTAACTTGGCTATGGTTACTGTGCTTTAAATAAAAAAGTGCATAAAAACTGATTCCATCCCACGTGCCATAGAGGATTAAAACTATAACTTCTTAAAAACTAGCATGATTAAAGGGATAGTCCACCCCAGAATTAAAATTCTCACTATTTACTCACGCTCAATTGGTTCCTAACCTAACCTGTTTTTTTTTGTTTTTTTTTTGTTCAGTTGAACATGAAAGTTGATATTTTGAAAAAAGTTGAAAAATTGACTGATTTCCATTGTAGGACAAATAAATGGTTACAGGTTTTCAACAATCTTCAAAATATCTTCTTTTTTGTTTAACGGCAAAAAGAAATTCTTAAGGTTTGAAAAACTTAAAGGGTGAATAAATGGATTATCTGCACCATTAAATAAATAATAATCAAAAAAATATTTCTGCAATGCTAAAGAAACCACATTAGCAATTATTGTGTGGTTGTGTTTCC[A/G]GACAAGCTGTGGTACTGTCGACTCTCTCCTAACCATAAAGTGCTGCACTATGGAGATGTTGAGGAGGAGACGGAGATGCCCTCCATCGAGGCGCTTCAGGATAAGAGTATGTGCATTTCAGATATCCTAATATACGAGTTTTCCAGTAGCTGATATTTGAACTTCAGTGTATAAAGTTGAATTTTGCTTGAATGTCCCCTCAGTTCCTGTGGCAGACATTAAGAATGTGGTGACTGGAAAAGACTGTCCTCACATGAAGGAGAACAAGGGAAAACAAACTAAGGTATGACGCTCGAACACAAGGGGTGGGATGCTTCACTAAATTGTTGGTTTGGTTTGTATCGTGGTTTACATTTGGTTCACATTATAGAACATCTTTGGGATGAATTAGAGAGGGAGACTGTGAGCCAGGCCTCACAAACACTTTTCTAGAAGAATTATAGTTGCACCGAAATGAAAATTCTTAGCTGAAACCGAAAACCAAAACACCAAAATAAATG
Associated Phenotype:
Not determined