Busch Lab

ZMP

si:rp71-68g1.4

Ensembl ID:
ENSDARG00000042114
ZFIN ID:
ZDB-GENE-070912-715
Human Orthologue:
BIN1
Human Description:
bridging integrator 1 [Source:HGNC Symbol;Acc:1052]
Mouse Orthologue:
Bin1
Mouse Description:
bridging integrator 1 Gene [Source:MGI Symbol;Acc:MGI:108092]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa217 Nonsense Available for shipment Available now
sa25417 Nonsense Mutation detected in F1 DNA Not yet available
sa13925 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa217
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081606 Nonsense 20 567 1 19
ENSDART00000144600 None None 192 None 5
ENSDART00000146424 Nonsense 20 386 1 14
Genomic Location (Zv9):
Chromosome 9 (position 7486049)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 7466142
GRCz11 9 7444533
KASP Assay ID:
554-0156.1 (used for ordering genotyping assays)
KASP Sequence:
AATTACCGATGGGGAAAGGGGTGTCCGCTGGAAAAATAGCAAGCAATGTA[C/T]AGAAGAAAATTACTAGAGCACAGGAGAAGGTAAGATATTTTAATAATCAC
Long Flanking Sequence:
TCAATGAAAACATCAAATGTTTTAATTTGTACTCTTCTGTGTGGAGTATTTAAATTAATATCTAATAGAGAAATGTCAATTATTTAAAATGCTAACTGATCTTCTTCTAGTGTCCATTTTTAAGCAGAAAAGCACATTTTTCATCATCATGTTCCGCACCACGGAATGTGGTGAGAAGGATTTGCCATATTATTTTACTGCTTCGTTGCTGTGCCATGAAAAATGGTGTCCTGTCCCTTTAAGACTGCGCTTTTGTCATTGGTCAGTGACCATCTGTATCGTGTGCGCTTGTGCAGCTTCATTCTAGTCCAGGGGCGAGTGTTATTATAAGGCCTAAAATATCTAGCTACCTGCATTGAGGAAAATACAGCTCTGTTGAATTACATATTTAACACATGTTCATTTGACGCGGTATCCTGCAAGAACCACAATCCGGATAAAAAATGGCTGAATTACCGATGGGGAAAGGGGTGTCCGCTGGAAAAATAGCAAGCAATGTA[C/T]AGAAGAAAATTACTAGAGCACAGGAGAAGGTAAGATATTTTAATAATCACGTGTATAATCAAATACATCCTCTGATCTCGGTGTTATCTACATTACAGCACATTAAAGCATTAAAGGCCAATGCATCGTCCTCTAGCGAGCTCTATAAACCTGCAATGTGACAGAAAGGCTCGTCCATAGTTGACTAGGAAATACTACAGTAAATGCATTTGTCTGCTCTATATTGTGCGGATGTTTAAATATATTTATATAACAGTTCTGAAGGCTCAAGCTCTGTTTATTTCATTGCTGTAAAGGCTGCTATGGAAACTACATGAACGCTTAGCCTGTTACACTGGATTTCTATACTAGCATTGAACACCATGAAGATCTCTTCGTGATTTAAGCTTAAATCCACCCATTTATTATGTCTACCCTGCATTAACCTAACCGTACTTATCTATTAGATGAGCGCGGCGATGATGCACGACTCGTGAACGAGTCATTCCTTTGAATAGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25417
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081606 Nonsense 55 567 2 19
ENSDART00000144600 None None 192 None 5
ENSDART00000146424 Nonsense 55 386 2 14
Genomic Location (Zv9):
Chromosome 9 (position 7483592)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 7463685
GRCz11 9 7442076
KASP Assay ID:
554-7547.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGAGACTAAAGATCTGGCGTTTGAGGAGGGCGTGATCAACTTTAATAAA[C/T]AGTTGGTGAGTGGCTTTCTGACTGTACACGATATTTCTTCAAACGTCCAT
Long Flanking Sequence:
TGTTCCCCAGTACTGGGCATCCGCTGTGTAAAACATATGTTGTAAAATGTGGCGGTTCCTTCCACTGTGGTGACCCCTGATGAATAAAGGGACTATGAGTGGAGAAATGAGTGCATAAATGTAATATTTAATAAAGCAAATAGCCAGTTTAGTTGTATTTTTAAATATTTATTTTAAACATTTTTTATATTATAAAGCAAAACGTTGAGTTCTTTTTTTTTGTTATTATACCATAGCCTTATTTTTTTAGCTTAAGTCAGTATCGTGATAATATTGTATCACAATTAAAGCTTCAGCAGTTATTGCATGAAAATGGGATATCATTGGAAAACATTAATCATGTTAATTAATGATTAAACAAATTAAAATAACTACGACCAGAGGATTGCGTTGTCAATAATATCACCATCATCATCTTCTGGCAGGTTATGCAAAAGCTTGGAAAGGCAGATGAGACTAAAGATCTGGCGTTTGAGGAGGGCGTGATCAACTTTAATAAA[C/T]AGTTGGTGAGTGGCTTTCTGACTGTACACGATATTTCTTCAAACGTCCATCAGGAATTGTGGCTTTGGCCTGTGTATCTCTGTCTTAGTTTTGTCCTGTGCTCAAATAGGTGGAAGGTACCAAACTGCAGAAAGACCTTCGGGCCTATTTGACTGCTGTGAAAGGTACGATTATGATGAAATTACACACCTGCGACATGAAATGAAATGTGTTGATTTCTTAGTCTTGCTGATGCTTTTGGCTTCCCCTCAGCCATGCACGAGTCTTCTAGACGTCTGTACGAGTGCCTGGATGACATGTATGAGACAGAGTGGTACGGCAGAAAGAAAATGGACGCAGTTGTAGAGGTTATTGTTTTATTTTAATATCATTGTCAATAAAATGTCTTTCATTGTATATATATAGGACATCAGGAAAGTATTCATAGCGCTTCACTTTTTCTACATTTTTTATGTTACAGCCTTATTCCAAAATGAATTAAATTCATTTATTTCCTCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13925
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081606 Essential Splice Site 74 567 3 19
ENSDART00000144600 None None 192 None 5
ENSDART00000146424 Essential Splice Site 74 386 3 14
Genomic Location (Zv9):
Chromosome 9 (position 7483427)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 7463520
GRCz11 9 7441911
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGGTACCAAACWGCAGAAAGACCTTCGGGCCTATTTGACTGCTGTGAAAG[G/C]TACGATTATGAWGAAATTACACWCCTGCGACATGAAATGAAATGTGTTGA
Long Flanking Sequence:
TATTTATTTTAAACATTTTTTATATTATAAAGCAAAACGTTGAGTTCTTTTTTTTTGTTATTATACCATAGCCTTATTTTTTTAGCTTAAGTCAGTATCGTGATAATATTGTATCACAATTAAAGCTTCAGCAGTTATTGCATGAAAATGGGATATCATTGGAAAACATTAATCATGTTAATTAATGATTAAACAAATTAAAATAACTACGACCAGAGGATTGCGTTGTCAATAATATCACCATCATCATCTTCTGGCAGGTTATGCAAAAGCTTGGAAAGGCAGATGAGACTAAAGATCTGGCGTTTGAGGAGGGCGTGATCAACTTTAATAAACAGTTGGTGAGTGGCTTTCTGACTGTACACGATATTTCTTCAAACGTCCATCAGGAATTGTGGCTTTGGCCTGTGTATCTCTGTCTTAGTTTTGTCCTGTGCTCAAATAGGTGGAAGGTACCAAACTGCAGAAAGACCTTCGGGCCTATTTGACTGCTGTGAAAG[G/C]TACGATTATGATGAAATTACACACCTGCGACATGAAATGAAATGTGTTGATTTCTTAGTCTTGCTGATGCTTTTGGCTTCCCCTCAGCCATGCACGAGTCTTCTAGACGTCTGTACGAGTGCCTGGATGACATGTATGAGACAGAGTGGTACGGCAGAAAGAAAATGGACGCAGTTGTAGAGGTTATTGTTTTATTTTAATATCATTGTCAATAAAATGTCTTTCATTGTATATATATAGGACATCAGGAAAGTATTCATAGCGCTTCACTTTTTCTACATTTTTTATGTTACAGCCTTATTCCAAAATGAATTAAATTCATTTATTTCCTCAAAATTGTACACACAATACCCCAAAATGACAATGTGAAAAAAGAGTTTTTGAAATTGTTGGAAATTTATTAAAATAAAATGCAGGTATATTCTATTTCCATTGATCATTCTTGAGATGTTTCAGCAGCTTAACAGGAGTTCAGCTGTGGTCAATTCAGTTGATTGGGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3728
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site, Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081606 Splice Site None 567 None 19
ENSDART00000144600 None None 192 None 5
ENSDART00000146424 Essential Splice Site 293 386 12 14
Genomic Location (Zv9):
Chromosome 9 (position 7468165)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 7448258
GRCz11 9 7426649
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAAGGGACTATTCATAGTGAAACTATATTTAGAKTAGWATCTATATTTTA[T/A]GCTTTAGTGAAAGAACACAAGATGCCAATCACACTTTAAGYCCAGGAGGA
Long Flanking Sequence:
AATAACTCAGAATTCTGACTTTATATCTCATAGTTCTGAAAAATAAAGTCGCAATTGTTTGATAGGAAGTCAGAATTCGTAGATAAACATTTATCTGACATTGGCAAAAAGAACACATTAAAAATCATCACAGGACTGTCCCGTAATGGATTTTTGATGTGTTTTCTGATGCCATATTTAGATGTCATCTAGACATCAAGTTAGTCAATCGGCATCAAATTGATTAGCATCTTTGACGTTTTTTTAATGTCATTTTGAAATCAAGGTGTGCACTAGGAAGCAACTGCGTCTCAATATGCATGTGTAACTACAATGATACTATGTTTACTACAGTTATGTCCATATTTGCTTGGAAGTATCCCAGATAGACTTCTTTGGTCATACTGGTCATCTAAGACTAGACCTTGCCGTGTGAAGCATTGGTGTGACGCATTGGACAAAGCCTGTCATAAAGGGACTATTCATAGTGAAACTATATTTAGATTAGTATCTATATTTTA[T/A]GCTTTAGTGAAAGAACACAAGATGCCAATCACACTTTAAGTCCAGGAGGACCACCAGCCATTCCCAAATCGCCGTCTAAGGTATTTTAATGCATCTCTGAGATGTTTGTAATTGGTTGTTTCAGTGAATGTTCTTAGTTCTCTCAGGCTTAATATTAAACATATTTCTGAATTATCTACATTTCCAGCTAAGGCCTGCAGTTCCTCCTCCTCCCAAAGTAACTCCGTCAAAGGACCTGAAGCAGGAGAGCATCATCAACCTGTTTGAAGAGGCCGCCACACCAAACATCAGTGTCACCTCACCAACAGAGGTCAGCAGAAACTTTCTTCTCCTGTAATCCTTGTGTATTCTTGCTGCATGAATGACAGAAATGTTGAATTTGAGCTGGAATAAATTAAATTACTGAATTGAAATTCAGTAAACATTGTTGGTATAAAGAAAATGGGAAACAGGACGTTTCCAGTGGGCAAAAACGTGTCTAAAATGAAAATCTATTTGGT
Associated Phenotype:
Not determined