Busch Lab

ZMP

ENSDARG00000042107

Ensembl ID:
ENSDARG00000042107
Mouse Orthologue:
Cngb1
Mouse Description:
cyclic nucleotide gated channel beta 1 Gene [Source:MGI Symbol;Acc:MGI:2664102]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa6803 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa6803
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061712 Essential Splice Site 327 716 7 17
Genomic Location (Zv9):
Chromosome 25 (position 17879318)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 17423182
GRCz11 25 17519582
KASP Assay ID:
554-4845.1 (used for ordering genotyping assays)
KASP Sequence:
CGACAAGAAATTGATGAGAGCTAATTACATCAAAACAGCACGTTTTAAGG[T/C]AAAGATACAYTTATGAAGGTTATTGTTGTTTTATYATATCAATATTATTC
Long Flanking Sequence:
TTGTGAACTTATTGGCTTTCTTGCAATTCTGTTTCTTCTTCTCCTAATTTTTTTCTCACTTAATCATTTTTATTCTGTAGCAGAAGCTAGCTTTCATAGTTCTTTATTAAACATGATTTTAATAAAATAAACAATTACTTTAAAACTCTCTGTAGATCTGTTCTACGTGCTCTGGCTGTTCTGCGTGTCTTTGGCGTTCAACTGGAATGCATGGATGATTCCTGTGCGTTCAACTTTTCCTTATCAAACACCGGAAAACATCCACGTGTGGCTGTTGATAGACTACTTGTGTGATAGCGTCTACATTCTGGACGTCCTGGCCTTTCAACCCCGACTGCAGTTTGTCCAGTATGGGGACATTGTGGTAAATATAGCTTAAAATAATAGAATATTTAAAATAAAACAATTACTTTGTTCACCCAATCTTTTGTGGAATATTTGTTTTTAGAGCGACAAGAAATTGATGAGAGCTAATTACATCAAAACAGCACGTTTTAAGG[T/C]AAAGATACATTTATGAAGGTTATTGTTGTTTTATTATATCAATATTATTCAGACTTTTTTTTTGAGGTGCTGAACACATGTAGTCTAAATAGGATCTCATTTCCTGTGTCGCAGCTGGATGTGCTCAGTCTACTTCCTCTGGAGCTTCTCTACTTCAAAACAGGGATTAATCCGCTCCTCCGCTTACCCAGAATCCTGAAGGCAAGCTGATTTTCTATCATCTAACTTGCTTAAGGAATATCTGTCCATGAGAAATGCTGTTAAATGTGTCCTTCTTTTCTACAGTTCATGGCTTTCTTTGAGTTCAACAAGCGTCTGGAAGCTATCTTGACCAATCCTTACATTTACAGGTTAGTTTATAGACATTGAAACTTTGTATTTTATAACTTTGTAGACATTGTTGCATATTTCTGGTTTTGTTTTATCAGAGTCATTCGAACAACCACTTACCTGCTGTTTGCCGTCCACTGCAATGCCTGTCTTTATTACTGGGGCTCTTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30232
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061712 Nonsense 420 716 11 17
Genomic Location (Zv9):
Chromosome 25 (position 17876377)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 17420241
GRCz11 25 17516641
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGTTTAGAAACAAACAATTTCTTCTGTTTGCTTTGTGAATTTCTAGTTA[C/A]ATTCGCTGTTACTACTTTGCTGTGAGGGCTCTGCTGACCATCGGGGGCCT
Long Flanking Sequence:
TTAAGAATGTGCTCAGCAGCGCTCAAATGTTAGCGGAAAATGAACGTTTTTTAAACAGTATCGATTAGTACCGATTTCCAGTATCGTGACATCTCTAGTGTGCCCACCGATAAAAACTTCTGCATGCATGCTTGACAGCCTACACCTTTTATACATCTTTTTGTAAATTCTATTTGCTGTAATATACCCTATGCTGAGGTAAGAGTGACTTTAGTTCCTGCAATGTGAAAGCACCAAAATAAAAATAAAAAATTCCACCACTAGTTCTAGGAACTATGAAAAAGTACTTCTGGTGTCAAAGCCCCTAAAAGGAACATCGGACATAGGAACTGAACACTGGAAACAAATGAGGGCAGTAATTGCATTTCAGGGGAAAATAAACAAGGAGAACAAAACCGTTTTATCTTTTAATGCAATAATTTAAAAATAGTAACTTTTAAAACTAAAATTCTGTTTAGAAACAAACAATTTCTTCTGTTTGCTTTGTGAATTTCTAGTTA[C/A]ATTCGCTGTTACTACTTTGCTGTGAGGGCTCTGCTGACCATCGGGGGCCTGGCAGGACCCACCACACTTTTTGAGTTGGTGTTTCAGCTCATCAATTATTTCAGTGGAGTGTTTGTGTTCTCCATCATGATTGGTCAGGTAAGGCCATTATAATGAGGGCATTATTAAGGATCTACAGATGAGTTTCTTTCTATATGACTGACTTAGGCTTGTATTGTTTCAGATGAGAGATGTCGTAGGCGCAGCCACTGCGGCGCAGACAAACTATCGTGCCTGTGTTGATAATACAGTGAAGTATATGGCCTCTTACCGTATCCCTAAAGATGTGCAGAAGAGGGTGAAAACCTGGTACAGCTACACATGGCAGTCCCAAGGCATGCTGGGTAAGACGTCAGTGGCAGTGGGACAGACCGCAACATAAATTTACAAAAGACATTAATGCATAAAACCTTTATCAAATGATGATGAATTTTGACCTTTTGTGTTATTACTTAGATGAA
Associated Phenotype:
Not determined