Busch Lab

ZMP

zgc:85682

Ensembl ID:
ENSDARG00000042081
ZFIN ID:
ZDB-GENE-040426-2502
Description:
somatostatin receptor type 5 [Source:RefSeq peptide;Acc:NP_998462]
Human Orthologue:
SSTR5
Human Description:
somatostatin receptor 5 [Source:HGNC Symbol;Acc:11334]
Mouse Orthologue:
Sstr5
Mouse Description:
somatostatin receptor 5 Gene [Source:MGI Symbol;Acc:MGI:894282]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa5992 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa37851 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa5992
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061674 Essential Splice Site None 383 2 3
Genomic Location (Zv9):
Chromosome 24 (position 16787705)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 11146433
GRCz11 3 11112976
KASP Assay ID:
554-3810.1 (used for ordering genotyping assays)
KASP Sequence:
ACCTTTTTACACTTGAGATGATAACACCATTGYGTTCTCATTTTGCTTTC[A/T]RCCCCCCYGGTGACCAMATTTGCRCCTKTATCCAAACATGGCAACCCAAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8033
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061674 Essential Splice Site None 383 2 3
Genomic Location (Zv9):
Chromosome 24 (position 16787706)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 11146434
GRCz11 3 11112977
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCTTTTTACACTTGAGATGATAACACCATTGYSTTCTCATTTTGCTTTCW[G/A]CCCCCCYGGTGACCAMATTTGCRCCTKTATCCAAACATGGCAACCCAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37851
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061674 Nonsense 35 383 2 3
Genomic Location (Zv9):
Chromosome 24 (position 16787845)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 11146573
GRCz11 3 11113116
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTCCTCCAGTGACCCTAATGAAAATCTGCTGGCTGAAGAAGAAAGCACT[A/T]AAGCCCTGGCTGTGATCTACCTCGTGGTGTTCATCGTGGGTCTGACAGGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30071
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061674 Nonsense 356 383 2 3
Genomic Location (Zv9):
Chromosome 24 (position 16788810)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 11147538
GRCz11 3 11114081
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCGTTCTTTCCTCCGAGAAGCTTCGATTATAATGACCACGTCCAGAGCTA[T/A]CAAGTAAGGTGCTTTAATTCTGAATATTTTAATAATATATTTGTTAAAAA
Associated Phenotype:
Not determined