Busch Lab

ZMP

si:dkeyp-35f12.2

Ensembl ID:
ENSDARG00000042071
ZFIN ID:
ZDB-GENE-090313-384
Human Orthologue:
PAM
Human Description:
peptidylglycine alpha-amidating monooxygenase [Source:HGNC Symbol;Acc:8596]
Mouse Orthologue:
Pam
Mouse Description:
peptidylglycine alpha-amidating monooxygenase Gene [Source:MGI Symbol;Acc:MGI:97475]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa45393 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa16146 Essential Splice Site Available for shipment Available now
sa15072 Essential Splice Site Available for shipment Available now
sa21661 Nonsense Available for shipment Available now
sa34842 Splice Site, Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa45393
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061639 Essential Splice Site 91 909 3 24
ENSDART00000136976 Essential Splice Site 91 1017 4 27

The following transcripts of ENSDARG00000042071 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 7700290)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 5709340
GRCz11 10 5710559
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TACTACTGTATGGCTGTTCCTGTCCCAACCTCACGGGAGGCCTATATTGG[T/A]GAGTAAAGGTTTTATTAACTGTAGTAAGCACAATTTCTATATAATTTCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16146
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061639 Essential Splice Site 120 909 4 24
ENSDART00000136976 Essential Splice Site 120 1017 5 27

The following transcripts of ENSDARG00000042071 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 7706527)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 5715577
GRCz11 10 5716796
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACATGATTTTATATGGCTGCAAAACCCCTTATGCTACTCAAGGATACTGG[T/A]GAGTTCCCTCTGATAYTTTTATAAGCATTTTCATTTGCAGACAAAACTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15072
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061639 Essential Splice Site 370 909 12 24
ENSDART00000136976 Essential Splice Site 370 1017 13 27

The following transcripts of ENSDARG00000042071 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 7734850)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 5743900
GRCz11 10 5745119
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGGCCAGACCATATGATGTCCATGAAGCATGAAKCTTNNNCTCAAAAAG[G/C]TACCGTACAAAATCAAACACTTCAAGATTTTTCATACACAACTCTACATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21661
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061639 Nonsense 385 909 13 24
ENSDART00000136976 Nonsense 385 1017 14 27

The following transcripts of ENSDARG00000042071 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 7735049)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 5744099
GRCz11 10 5745318
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCATTTAGATGCTGTGGAGCTTCAGGAGCCCAAGAGAGATGAGGAAGTA[C/T]AGGATCAAGGTAAGCTTTTAAAATAATTCATAAGAGAATTTTGTTCATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34842
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061639 Splice Site, Nonsense 672 909 19 24
ENSDART00000136976 Splice Site, Nonsense 780 1017 22 27

The following transcripts of ENSDARG00000042071 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 7765207)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 5774257
GRCz11 10 5775476
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCATCAATTACTCAAGCAAGGAAATCCTGGATTCCTTCAGTCCAGACACA[C/T]AGGTACAGATTGCAGCACATTCGGTACATACAATGTGCACACTCAGCTGA
Associated Phenotype:
Not determined