Busch Lab

ZMP

si:dkeyp-7g10.1

Ensembl ID:
ENSDARG00000041982
ZFIN ID:
ZDB-GENE-091113-9
Human Orthologue:
ADAMTS6
Human Description:
ADAM metallopeptidase with thrombospondin type 1 motif, 6 [Source:HGNC Symbol;Acc:222]
Mouse Orthologue:
Adamts6
Mouse Description:
a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 6 Gene [

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa14859 Nonsense Available for shipment Available now
sa13308 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14859
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009715 Nonsense 471 1117 10 24
ENSDART00000138748 Nonsense 470 1116 10 24
Genomic Location (Zv9):
Chromosome 10 (position 11643859)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 11719725
GRCz11 10 11677963
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTTTGACAGCTCAGGTCGGGGAACGTGTCTGGACAATGAGCCTCTAAAA[C/T]GAGACTTCCTGTACCCCACTGTGGCTCCAGGGCAGGTGTACGATGCAGAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27572
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009715 Essential Splice Site 812 1117 18 24
ENSDART00000138748 Essential Splice Site 811 1116 18 24
Genomic Location (Zv9):
Chromosome 10 (position 11587500)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 11663366
GRCz11 10 11621604
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAATCACTTGAAGCTCTAGGGGCCACCATGGAAAATTTGGTGGTTATGG[T/C]GAGTAGATGTTAATCTTTCTTTTATTCAAAATAAAATATTGTTAGTACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13308
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009715 Nonsense 908 1117 21 24
ENSDART00000138748 Nonsense 907 1116 21 24
Genomic Location (Zv9):
Chromosome 10 (position 11571183)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 11647049
GRCz11 10 11605287
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAAAGTTAATTCTATACCATGTTGTATTCCAGATGGTTTATCGGCGACTG[G/A]TCAGAATGTGGAAAAACCTGTGATGGAGGGATCCGGAYACGTACTGTTCT
Associated Phenotype:
Not determined