Busch Lab

ZMP

A7MC08_DANRE

Ensembl ID:
ENSDARG00000041960
Description:
Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:A7MC08]
Human Orthologue:
OLFM4
Human Description:
olfactomedin 4 [Source:HGNC Symbol;Acc:17190]
Mouse Orthologues:
E030002O03Rik, Olfm4
Mouse Descriptions:
RIKEN cDNA E030002O03 gene Gene [Source:MGI Symbol;Acc:MGI:2443346]
olfactomedin 4 Gene [Source:MGI Symbol;Acc:MGI:2685142]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa43018 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa43018
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061497 Nonsense 468 470 5 5
Genomic Location (Zv9):
Chromosome 17 (position 53110131)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 52495698
GRCz11 17 52581998
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCTCTACATGTTCAATAATGGCTACTATGTGACTTACAATCTGAAGTTC[A/T]AGGTTGTTTAGGAAGGATCAGTGTGTTCAGGACTGACCGTATGCATGGCG
Associated Phenotype:
Not determined