Busch Lab

ZMP

styk1

Ensembl ID:
ENSDARG00000041947
ZFIN ID:
ZDB-GENE-030131-3435
Human Orthologue:
STYK1
Human Description:
serine/threonine/tyrosine kinase 1 [Source:HGNC Symbol;Acc:18889]
Mouse Orthologue:
Styk1
Mouse Description:
serine/threonine/tyrosine kinase 1 Gene [Source:MGI Symbol;Acc:MGI:2141396]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa7428 Missense Mutation detected in F1 DNA Not yet available
sa424 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa7428
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061477 Missense 24 425 2 11
ENSDART00000139664 Missense 19 447 2 10
Genomic Location (Zv9):
Chromosome 16 (position 34288896)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 32020396
GRCz11 16 31974426
KASP Assay ID:
554-4273.1 (used for ordering genotyping assays)
KASP Sequence:
GGCCTCTTCCAGCGCTGCATCTTCTGAATGTGAGSCTGGAGATGCGCTGT[G/A]TGGTAAGTAGATCRTGTCTGTGAGATYAAATAAAGGAATCATGACCATCC
Long Flanking Sequence:
TGTAAGTTGACGTGTGCTTGCAAAGTTTTTTATAGTCAGTTAAATGTCTGTTGAAGGAGCAGTATCGACAGATATTAAGCAGACAATATACTAATACTCAAATGGACCATTAAAATAAAGTGTTGCCAAAATCAGTAATTTTTTCTCCTTACTCTGACCGTGATCCTTACAGATAAAAAAAAAAAAAACTCTCTGGAAAGGACACTGATCGTGAAAGATCTGTGAAGTCTCAGCTGCCAAAGTCTTTTCATGTTGATAACAAAGATCATGTTTCACTGACCCTGAATCCAACTCATAATATTTCATACTGACATTGTGAGAGGTTTATTTTAGCTTCAGTGATCTCTGCATCTGGAAATCCACTTATACTTTGGTCAACAAATAATAAGTAGATCATTAAAAAACACCTCCAACCTTTTAAATTACCTTTTGGTATCCGTGCAGGATGGCGGCCTCTTCCAGCGCTGCATCTTCTGAATGTGAGGCTGGAGATGCGCTGT[G/A]TGGTAAGTAGATCATGTCTGTGAGATCAAATAAAGGAATCATGACCATCCTTCAACTACATTATCAAAGTTGTCATTTGAAATGTCCCTTTTACTCCTTGACCCCAGAAATTCGTGTGTATGAACAAGAGGTGATAATCGTACCGGTGATCTTCTTCATGATGTTCTTGATCACGCTGCTATTCATTATGCTGCTGAGGTTCTGTCCAGAGAAGGTGGAACGCCTGCAACCTGCTTCCAGTCGAGTATCCAGGACTAGGAGAAACTTGCAGGGCATTGATGGTCAGTATATAAAAGGAGTATAATATTCATTCATTTTCTTTTCGGCATAGTCCCTTTATTAATCAGGGGTTGCCACAGCAGAATGAACCACCAACTTATCCAGCAAATGTTTTACACAGCAGATGCCTTTCCAGCTGCAACCCATCACTGGAAAACATCCACACACATTCATTCACACACATACCCTACAGACAATTTAGCTTACCCAATTCATCTATA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28693
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061477 Nonsense 202 425 6 11
ENSDART00000139664 Nonsense 224 447 5 10
Genomic Location (Zv9):
Chromosome 16 (position 34287144)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 32018644
GRCz11 16 31972674
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGAGCTGCTGGGAGTAATATCCTTGCGGGCTCCTCTCATTACTGTTATT[G/T]AGGAGATGGAGAACAGAGATCTGCTTGGATTCTTGTGGAGATGTAGACAG
Long Flanking Sequence:
GGGAGCCCATAGCACTGGACACAACCACTTACATGACATTCAACCCTGCAACGCCAGCCAGGCTCGATCACGCCAACAATGTTGCCTTTACTGATGGCATGTTTGGCGCCACAGCTTCAGCCTTTGCAAAGCCACGAGAACTTCCACGCCAGCGACTGCCGGAGAACTTTAACGGAGTCGCTCCTCTCCCAGCTTCATACTCACTGAAGTCAGACAGCCCCATCTCGCTCTATAGGGCTCGTATGGAAAACAGAAATGTGGTGCTTCGTGTGCTTAAAGGTGCCCATGAGGTTTTTTAACTTGCACTTAATGTCTGACTGAGATCTTGAATTCCAGGTACACTGACCCTCTTTTAAATCTCATCCTCAGATTCAGCCAGTAATCAGGAAAGTCAGTCATTCTTGGGATTTGCGGCCTTTCTGTCCCAGTTAGGGCCTCATCCCTTCTTACCAGAGCTGCTGGGAGTAATATCCTTGCGGGCTCCTCTCATTACTGTTATT[G/T]AGGAGATGGAGAACAGAGATCTGCTTGGATTCTTGTGGAGATGTAGACAGGTAAAAGATTTGACTATACGTTTCATTGCTGCGTTTTTTTTTAAGCCGAAGAAAATTATATGATTATATGACAACAGTGTACACACCTTTTTGTTCCTGAAAAGCAAATGCAGCTTTATAAGCATTTGTTTTTGGACAGTTTTATATTGTATATTTATTTACTTGTTTCTACTGCTTTTTTCTAGTTTTACTTACAGATGGAGTAGATTATGTTGTCAATACCACCCTTGTTCACAAGGATACATAAAATTACAAACAAAATGCTGCATTATGCTAGCCAAGCCAGTAGCTATTGCTGTTTTGGTTGTCATGTCATGTAGCCATAGAATGTTTGAGCATGATCACACCAACCTCTGACTGATTTCACATTTTGAATTTGGTTTATGTTCATTTTTACTTAGATTTTATTACTTTACATGACAACAACAGCAGTTTTGCACTATGAAACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa424
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061477 Essential Splice Site 218 425 6 11
ENSDART00000139664 Essential Splice Site 240 447 5 10
Genomic Location (Zv9):
Chromosome 16 (position 34287093)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 32018593
GRCz11 16 31972623
KASP Assay ID:
554-0371.1 (used for ordering genotyping assays)
KASP Sequence:
AGGAGATGGAGAACAGAGATCTGCTTGGATTCTTGTGGAGATGTAGACAG[G/A]TAAAAGATTTGACTATACGTTTCATTGCTGCGTTTTTTTTTAAGCCGAAG
Long Flanking Sequence:
CGCCAGCCAGGCTCGATCACGCCAACAATGTTGCCTTTACTGATGGCATGTTTGGCGCCACAGCTTCAGCCTTTGCAAAGCCACGAGAACTTCCACGCCAGCGACTGCCGGAGAACTTTAACGGAGTCGCTCCTCTCCCAGCTTCATACTCACTGAAGTCAGACAGCCCCATCTCGCTCTATAGGGCTCGTATGGAAAACAGAAATGTGGTGCTTCGTGTGCTTAAAGGTGCCCATGAGGTTTTTTAACTTGCACTTAATGTCTGACTGAGATCTTGAATTCCAGGTACACTGACCCTCTTTTAAATCTCATCCTCAGATTCAGCCAGTAATCAGGAAAGTCAGTCATTCTTGGGATTTGCGGCCTTTCTGTCCCAGTTAGGGCCTCATCCCTTCTTACCAGAGCTGCTGGGAGTAATATCCTTGCGGGCTCCTCTCATTACTGTTATTGAGGAGATGGAGAACAGAGATCTGCTTGGATTCTTGTGGAGATGTAGACAG[G/A]TAAAAGATTTGACTATACGTTTCATTGCTGCGTTTTTTTTTAAGCCGAAGAAAATTATATGATTATATGACAACAGTGTACACACCTTTTTGTTCCTGAAAAGCAAATGCAGCTTTATAAGCATTTGTTTTTGGACAGTTTTATATTGTATATTTATTTACTTGTTTCTACTGCTTTTTTCTAGTTTTACTTACAGATGGAGTAGATTATGTTGTCAATACCACCCTTGTTCACAAGGATACATAAAATTACAAACAAAATGCTGCATTATGCTAGCCAAGCCAGTAGCTATTGCTGTTTTGGTTGTCATGTCATGTAGCCATAGAATGTTTGAGCATGATCACACCAACCTCTGACTGATTTCACATTTTGAATTTGGTTTATGTTCATTTTTACTTAGATTTTATTACTTTACATGACAACAACAGCAGTTTTGCACTATGAAACTCTTGAATTTTCTGTTTTCCAAAGCACTGATGGTGTGTAACTAATGTCAGAGT
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461