Busch Lab

ZMP

si:dkey-217m5.3

Ensembl ID:
ENSDARG00000041919
ZFIN ID:
ZDB-GENE-041014-320
Description:
hypothetical protein LOC794050 [Source:RefSeq peptide;Acc:NP_001076365]
Human Orthologues:
CCL11, CCL13, CCL15, CCL16, CCL2, CCL23, CCL24, CCL26, CCL7, CCL8
Human Descriptions:
chemokine (C-C motif) ligand 11 [Source:HGNC Symbol;Acc:10610]
chemokine (C-C motif) ligand 13 [Source:HGNC Symbol;Acc:10611]
chemokine (C-C motif) ligand 15 [Source:HGNC Symbol;Acc:10613]
chemokine (C-C motif) ligand 16 [Source:HGNC Symbol;Acc:10614]
chemokine (C-C motif) ligand 2 [Source:HGNC Symbol;Acc:10618]
chemokine (C-C motif) ligand 23 [Source:HGNC Symbol;Acc:10622]
chemokine (C-C motif) ligand 24 [Source:HGNC Symbol;Acc:10623]
chemokine (C-C motif) ligand 26 [Source:HGNC Symbol;Acc:10625]
chemokine (C-C motif) ligand 7 [Source:HGNC Symbol;Acc:10634]
chemokine (C-C motif) ligand 8 [Source:HGNC Symbol;Acc:10635]
Mouse Orthologues:
Ccl11, Ccl12, Ccl2, Ccl24, Ccl26, Ccl6, Ccl7, Ccl8, Ccl9
Mouse Descriptions:
chemokine (C-C motif) ligand 11 Gene [Source:MGI Symbol;Acc:MGI:103576]
chemokine (C-C motif) ligand 12 Gene [Source:MGI Symbol;Acc:MGI:108224]
chemokine (C-C motif) ligand 2 Gene [Source:MGI Symbol;Acc:MGI:98259]
chemokine (C-C motif) ligand 24 Gene [Source:MGI Symbol;Acc:MGI:1928953]
chemokine (C-C motif) ligand 26 Gene [Source:MGI Symbol;Acc:MGI:3589281]
chemokine (C-C motif) ligand 6 Gene [Source:MGI Symbol;Acc:MGI:98263]
chemokine (C-C motif) ligand 7 Gene [Source:MGI Symbol;Acc:MGI:99512]
chemokine (C-C motif) ligand 8 Gene [Source:MGI Symbol;Acc:MGI:101878]
chemokine (C-C motif) ligand 9 Gene [Source:MGI Symbol;Acc:MGI:104533]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa44948 Nonsense Mutation detected in F1 DNA Not yet available
sa43506 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa44948
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061434 Nonsense 59 136 3 4
ENSDART00000142164 Nonsense 26 103 2 3
Genomic Location (Zv9):
Chromosome 20 (position 39357828)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 39430240
GRCz11 20 39333119
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTTGCAGGTATATTAACAAAAGTTTTACATTTATTTTTCTGCAGGGTCA[C/T]AGGGTCCTGAAAAGTGCTGCTTTTCTTTTACCAATGCAAGAATTCCATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43506
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061434 Essential Splice Site 94 136 4 4
ENSDART00000142164 Essential Splice Site 61 103 3 3
Genomic Location (Zv9):
Chromosome 20 (position 39357634)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 39430046
GRCz11 20 39332925
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTGATTTGGTTTTGTGAAATAAAGAAAAATCTTTTCTTTTGAAAATGCA[G/T]TTTCATCATAAGGGCTCAAAGGGAGATCTGCACTAATCCAACTGAGAAAT
Associated Phenotype:
Not determined