Busch Lab

ZMP

si:ch211-245h14.2

Ensembl ID:
ENSDARG00000041910
ZFIN ID:
ZDB-GENE-041014-346
Description:
Novel protein similar to human zinc finger protein 512 (ZNF512) [Source:UniProtKB/TrEMBL;Acc:Q5RHA4]
Human Orthologue:
ZNF512
Human Description:
zinc finger protein 512 [Source:HGNC Symbol;Acc:29380]
Mouse Orthologue:
Zfp512
Mouse Description:
zinc finger protein 512 Gene [Source:MGI Symbol;Acc:MGI:1917345]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa5956 Nonsense Mutation detected in F1 DNA Not yet available
sa25143 Nonsense Mutation detected in F1 DNA Not yet available
sa3063 Nonsense F2 line generated Not yet available
sa13791 Nonsense Available for shipment Available now
sa39297 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa5956
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061413 Nonsense 129 374 5 11
ENSDART00000147787 Nonsense 116 418 4 9
Genomic Location (Zv9):
Chromosome 20 (position 38556768)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 38629180
GRCz11 20 38532059
KASP Assay ID:
554-3648.1 (used for ordering genotyping assays)
KASP Sequence:
AATGGTTTGTTCTAGGGCTGCACTGGAAGTTTCACTAGTATAATGGGTTA[T/A]GTATACMATATGAAGAAATGTGGCAAAGAGTCGTCCGAGCTGGAGAAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25143
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061413 Nonsense 157 374 5 11
ENSDART00000147787 Nonsense 144 418 4 9
Genomic Location (Zv9):
Chromosome 20 (position 38556852)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 38629264
GRCz11 20 38532143
KASP Assay ID:
554-7705.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCGAGCTGGAGAAACTTTTATTGAATTGTAAACACTGTGGAAAAGCATA[T/A]CGTTCCAGAGCGGGCCTGGAGTATCATCTCAAAAATGAACACAGTCCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3063
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061413 Nonsense 227 374 6 11
ENSDART00000147787 Nonsense 214 418 5 9
Genomic Location (Zv9):
Chromosome 20 (position 38557156)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 38629568
GRCz11 20 38532447
KASP Assay ID:
554-2774.1 (used for ordering genotyping assays)
KASP Sequence:
GAGAAATCGCCAGCGAGGAGCTGCTAAAGGAATGGCCCAAAAGAAAAGTC[C/T]AACGAGACCTGGTGCCAGATGACAGGAAGGTGCTGCAAAATATACACATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13791
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061413 Nonsense 228 374 6 11
ENSDART00000147787 Nonsense 215 418 5 9
Genomic Location (Zv9):
Chromosome 20 (position 38557159)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 38629571
GRCz11 20 38532450
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAATCGCCAGCGAGGAGCTGCTAAAGGAATGGCCCAAAAGAAAAGTCYAA[C/T]GAGACCTGGTGCCAGATGACAGGAAGGTGCTGCAAAATATACACATCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39297
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061413 None None 374 None 11
ENSDART00000147787 Nonsense 387 418 9 9
Genomic Location (Zv9):
Chromosome 20 (position 38563001)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 38635413
GRCz11 20 38538292
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCACAGCGACTCAAGAACTGAAAATGAAGAGGAAAGAGAGACGAAACCAA[C/T]AGAAACGGAAAGCAAGCGGACAGGAGAAAGACTGCTATGAATTCAGTGGC
Associated Phenotype:
Not determined