Busch Lab

ZMP

SLC7A1 (1 of 2)

Ensembl ID:
ENSDARG00000041874
Description:
solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 [Source:HGNC Symbol;A
Human Orthologue:
SLC7A1
Human Description:
solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 [Source:HGNC Symbol;A
Mouse Orthologue:
Slc7a1
Mouse Description:
solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 Gene [Source:MGI Symb

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa22589 Nonsense Available for shipment Available now
sa9799 Nonsense Available for shipment Available now
sa17253 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22589
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034376 Nonsense 307 637 6 12
Genomic Location (Zv9):
Chromosome 15 (position 7242280)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 7318150
GRCz11 15 7314638
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGCATTGTAGCCTCTCTCCTCATCTGTTTCGTCGCTTATTTCGGTGTTT[C/A]GGCTGCACTGACGATGATGATGCCGTACTACATGCTGGACAAAAACAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9799
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034376 Nonsense 334 637 6 12
Genomic Location (Zv9):
Chromosome 15 (position 7242199)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 7318069
GRCz11 15 7314557
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CATGCTGGACAAAAACAGTCCTCTGCCTGTGGCCTTCAAATATGTGRGCT[G/A]GGAAGGAGCGACGTACGCTGTAGCCGTTGGCTCTCTTTGTGCTTTGTCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17253
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034376 Nonsense 534 637 10 12
Genomic Location (Zv9):
Chromosome 15 (position 7236475)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 7312044
GRCz11 15 7308841
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATTTCAAACTTGGACTCTTGCAGTTCTTATCTCTCTGGCTTTAGTTTGCT[T/A]GATCATCACCTTGTTAATATGGCGGCAGCCKGAGAGCAAGACAAAACTTT
Associated Phenotype:
Not determined