Busch Lab

ZMP

ift172

Ensembl ID:
ENSDARG00000041870
ZFIN ID:
ZDB-GENE-040827-1
Description:
Intraflagellar transport protein 172 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q5RHH4]
Human Orthologue:
IFT172
Human Description:
intraflagellar transport 172 homolog (Chlamydomonas) [Source:HGNC Symbol;Acc:30391]
Mouse Orthologue:
Ift172
Mouse Description:
intraflagellar transport 172 homolog (Chlamydomonas) Gene [Source:MGI Symbol;Acc:MGI:2682064]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa44947 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4118
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061334 Nonsense 682 1745 20 48
Genomic Location (Zv9):
Chromosome 20 (position 38880520)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 38952932
GRCz11 20 38855811
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATAATGTTTATTGCTGTTGTTGTACAGGATGGTGATGGAACAGACCACTA[T/A]CAGGTGAAAGCACGGCTGGCCATGCTGGATAAGAACTTTAAGCTTGCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44947
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061334 Essential Splice Site 1404 1745 38 48
Genomic Location (Zv9):
Chromosome 20 (position 38908780)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 38981192
GRCz11 20 38884071
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGACAAACGCTACAAAGAGCACCTGAAAAATCAAGGCAAAGTTGACTCTG[T/C]AAGTTACCTTTGTTAATCTTCTAACTGCCACTAGAGAGAATAAAAAAGAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29426
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061334 Nonsense 1423 1745 39 48
Genomic Location (Zv9):
Chromosome 20 (position 38913652)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 38986064
GRCz11 20 38888943
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGAGTAGATGTGGTTGCTGCACTGGACATGTATGCAGAACGAGGACAGT[G/A]GGAGAAATGTATTGACACAGCCTCCAAACAGGTGCTGATTTTCCTGTTCC
Associated Phenotype:
Not determined