Busch Lab

ZMP

gnrhr1

Ensembl ID:
ENSDARG00000041866
ZFIN ID:
ZDB-GENE-090128-2
Description:
gonadotropin releasing hormone receptor 1 [Source:RefSeq peptide;Acc:NP_001138452]
Human Orthologues:
GNRHR, GNRHR2
Human Descriptions:
gonadotropin-releasing hormone (type 2) receptor 2 [Source:HGNC Symbol;Acc:16341]
gonadotropin-releasing hormone receptor [Source:HGNC Symbol;Acc:4421]
Mouse Orthologue:
Gnrhr
Mouse Description:
gonadotropin releasing hormone receptor Gene [Source:MGI Symbol;Acc:MGI:95790]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa30447 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa24785 Nonsense Available for shipment Available now
sa24784 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa30447
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061346 Essential Splice Site 174 377 2 3
Genomic Location (Zv9):
Chromosome Zv9_NA22 (position 33220)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 43620696
GRCz11 19 43216293
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTAACAGCACAAAATAAAAACTGATCTTTACAAATTGTTTTTCTCGTTTC[A/C]GTTATTTATTTTCAGGGCAATTAAAGCTGAAGGAGTTGACTTTGTGCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24785
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061346 Nonsense 289 377 3 3
Genomic Location (Zv9):
Chromosome Zv9_NA22 (position 30721)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 43618197
GRCz11 19 43213794
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCATTTGTGGTGTGCTGGACACCGTATTATCTGCTGGGCATCTGGTATTG[G/A]TTTCAGCCCCGAATGCTGCAGGTCACGCCGGAATACGTCCATCACGCCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24784
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061346 Nonsense 329 377 3 3
Genomic Location (Zv9):
Chromosome Zv9_NA22 (position 30603)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 43618079
GRCz11 19 43213676
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAACACGTGCTGTGATCCGGTCATCTACGGTTTCTTCACACCCTCGTTC[A/T]GAGCAGACATAACCAGCTGCTTCAGTAGGAGGAATCAAAACTGCTCTCCG
Associated Phenotype:
Not determined