Busch Lab

ZMP

tsc22d2

Ensembl ID:
ENSDARG00000041839
ZFIN ID:
ZDB-GENE-031001-12
Description:
TSC22 domain family 2 [Source:RefSeq peptide;Acc:NP_956403]
Human Orthologue:
TSC22D2
Human Description:
TSC22 domain family, member 2 [Source:HGNC Symbol;Acc:29095]
Mouse Orthologue:
Tsc22d2
Mouse Description:
TSC22 domain family, member 2 Gene [Source:MGI Symbol;Acc:MGI:1919283]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa14179 Nonsense Available for shipment Available now
sa8884 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa14179
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061315 Nonsense 378 556 1 3
ENSDART00000146430 Nonsense 378 556 1 3

The following transcripts of ENSDARG00000041839 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 38092210)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 35230928
GRCz11 22 35206677
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCCCYCARAGTGTGCCAAAGCAGAATGCAGCRCCCCAGCAGAACCAGCCT[C/T]AGGGAGTGCCCAGCGGGTCAGTTGTGGGACYGGGTGCACAGATGAGCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8884
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061315 Essential Splice Site 449 556 1 3
ENSDART00000146430 Essential Splice Site 449 556 1 3

The following transcripts of ENSDARG00000041839 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 38092426)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 35231144
GRCz11 22 35206893
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCAACAGCTTGTTCRGGATCGCCCTTCCCATCGACGGGGACGAGGACAGG[T/C]ACTGCTTTTCTCTCGCTGTCATTGCTCATWYGGGCGTTTGGTTCTTTTGC
Associated Phenotype:
Not determined