Busch Lab

ZMP

si:ch73-193m8.2

Ensembl ID:
ENSDARG00000041791
ZFIN ID:
ZDB-GENE-091204-429
Human Orthologue:
MGAT4C
Human Description:
mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme C (putative) [S
Mouse Orthologue:
Mgat4c
Mouse Description:
mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme C (putative) Ge

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa15529 Essential Splice Site Available for shipment Available now
sa14085 Essential Splice Site Available for shipment Available now
sa23268 Nonsense Available for shipment Available now
sa43072 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa15529
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113715 Essential Splice Site 6 478 None 4
ENSDART00000143744 None None 477 3 5
Genomic Location (Zv9):
Chromosome 18 (position 16050984)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 16402750
GRCz11 18 16391816
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGCAGTATTTTTTTANNTNCTGTTTTCTGCCAGATYACACCAGAATTGTTTCC[A/T]TCATGAGACTGGTGTTAAAGTACCTGGAWAAGATGAGGTGTTTCCGAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14085
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113715 Essential Splice Site 50 478 3 4
ENSDART00000143744 Essential Splice Site 44 477 4 5
Genomic Location (Zv9):
Chromosome 18 (position 16050068)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 16401834
GRCz11 18 16390900
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGGCTCAAAGCTTATGCTGCGATCTGTCTGWCTTGAATGTCATGTGTTTC[A/C]GGARGAAGATAAACGTCAGCTGCGAGAAACCTCAATGCATCCKCTGAACT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa568
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113715 Nonsense 87 478 3 4
ENSDART00000143744 Nonsense 81 477 4 5
Genomic Location (Zv9):
Chromosome 18 (position 16049953)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 16401719
GRCz11 18 16390785
KASP Assay ID:
554-0478.1 (used for ordering genotyping assays)
KASP Sequence:
CACACCTTTAAAGACATCACCAATTTTTCTGGAACAATCAATGTGACTTA[T/A]CGGTACCTCGCAGGAACACCTTTACCCAGAAAGAGTAAGACTGCATTTGC
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa23268
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113715 Nonsense 159 478 4 4
ENSDART00000143744 Nonsense 153 477 5 5
Genomic Location (Zv9):
Chromosome 18 (position 16047890)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 16399656
GRCz11 18 16388722
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGATTTCGACCTTGCGTGGTGTGAAAGCCTAGTTCAAGAAATCTCCAGA[A/T]AGTTCGGCCACCATATCATTGCGGGACGGCTGCTTGTAATCCATGCACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43072
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113715 Nonsense 249 478 4 4
ENSDART00000143744 Nonsense 243 477 5 5
Genomic Location (Zv9):
Chromosome 18 (position 16047618)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 16399384
GRCz11 18 16388450
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCCTCACCGCCCTAAAGAAAGTTGTGGCGTCCCGGGAGGGTTCATACTG[G/A]GTGATGCTGGAGTTCTCCAAACTGGGCTACATAGGAAAGCTGTACCACTC
Associated Phenotype:
Not determined