Busch Lab

ZMP

si:dkey-174k18.8

Ensembl ID:
ENSDARG00000041728
ZFIN IDs:
ZDB-GENE-030131-7478, ZDB-GENE-030131-7478, ZDB-GENE-070912-390
Description:
Novel protein similar to vertebrate mannosidase, alpha, class 1A, member 2 (MAN1A2) [Source:UniProtK
Human Orthologue:
MAN1A2
Human Description:
mannosidase, alpha, class 1A, member 2 [Source:HGNC Symbol;Acc:6822]
Mouse Orthologue:
Man1a2
Mouse Description:
mannosidase, alpha, class 1A, member 2 Gene [Source:MGI Symbol;Acc:MGI:104676]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa2510 Essential Splice Site F2 line generated Not yet available
sa15063 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5533
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102192 Nonsense 70 645 1 13
ENSDART00000144248 Nonsense 70 645 2 14
ENSDART00000147435 Nonsense 70 106 2 3
Genomic Location (Zv9):
Chromosome 9 (position 21591507)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 20747293
GRCz11 9 20558162
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTTTTTCTTCCTCCCGGACAATTCCAAACACAAGCGCTTTGACTTTGGTT[T/A]GGAGGACGTGTTGATACCGCACAWCGAGACCGAGAAGGAGTCGAGGCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2510
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102192 Essential Splice Site 104 645 1 13
ENSDART00000144248 Essential Splice Site 104 645 2 14
ENSDART00000147435 Essential Splice Site 104 106 2 3
Genomic Location (Zv9):
Chromosome 9 (position 21591610)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 20747396
GRCz11 9 20558265
KASP Assay ID:
554-3167.1 (used for ordering genotyping assays)
KASP Sequence:
AGTAGACAGGTCATACATGGTGTGGGAGCTCAYGACGAGCATCGGCACAG[G/A]TAAGAGCTTCAGATTCTCAAACACAACATGCGTTTTCATGTTTAAGTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15063
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102192 Essential Splice Site 262 645 4 13
ENSDART00000144248 Essential Splice Site 262 645 5 14
ENSDART00000147435 None None 106 None 3
Genomic Location (Zv9):
Chromosome 9 (position 21733516)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 20889302
GRCz11 9 20700171
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTTTAAAGAYGGCCAGGAGTGGATCGAGCAAAACCTGGATTTCAGTGTGG[T/G]AAGTGGCCAAGACACACACAACAACCACCANNNNNNNNACACTTCTCTTTGTAGGTCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27377
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102192 Nonsense 519 645 11 13
ENSDART00000144248 Nonsense 519 645 12 14
ENSDART00000147435 None None 106 None 3
Genomic Location (Zv9):
Chromosome 9 (position 21783149)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 20938935
GRCz11 9 20749804
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATTGTTTGCAGTGCTAAAGCTCGGTCCGGAGGCCTTCAAGTTTGACAGC[G/T]GACTGGAGGCTGTGGCTGTGAGACAGAACGAGAAATACTACATCCTGAGG
Associated Phenotype:
Not determined