Busch Lab

ZMP

rrbp1

Ensembl ID:
ENSDARG00000041703
ZFIN ID:
ZDB-GENE-030429-36
Description:
ribosome binding protein 1 homolog [Source:RefSeq peptide;Acc:NP_955463]
Human Orthologue:
RRBP1
Human Description:
ribosome binding protein 1 homolog 180kDa (dog) [Source:HGNC Symbol;Acc:10448]
Mouse Orthologue:
Rrbp1
Mouse Description:
ribosome binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:1932395]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa32402 Nonsense Available for shipment Available now
sa14710 Nonsense Available for shipment Available now
sa797 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29800
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061117 Essential Splice Site None 978 1 26
Genomic Location (Zv9):
Chromosome 22 (position 25559462)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 25059368
GRCz11 22 25086992
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGACTCCAAAAGTCAGCGGCGATTAATTATCACTGTGAGTTTGACCGCAG[G/A]TAAGCACAAACCTTTTATCACCATGTGTGTTTTTACAGCACCAATGCATA
Long Flanking Sequence:
CTTTTTTTGTTAAACGAAAAGAAAAAAAAAACATGTTTGGAACAAGTGAAGTTTTTGAGTAATTATGATGAAATTGAACTAACCTTTTAAGTTTGAATCCCTCATTAAACAAAAAAATATACTCATATGAAAAAAGTCACACAGTTTTTCTCACATACCAAATTATCGTTTGCCTTAATTGTCATATGCCACCAATGTGCAGAACATCTGTGCAGACGTCGTGTTCAAACAATAAAACATTACATCCTCAATTTTCATTTTGTATTTCTTATGCTTTCATCACTCGACGTCCCGCTCAGAGCTTCCCACCACACGCTTCTAGATACTACGCGTGACATGGTTGGTTTAAAGGGCGTTGATTGACAAGTGTTCGCCCAATCAGGTGTCAGCCTCAGGCCGCGTATCAGCTTCACAGGCGGGCGCTGCTGCGCCAGATCGCAAGAAGTGCCACGACTCCAAAAGTCAGCGGCGATTAATTATCACTGTGAGTTTGACCGCAG[G/A]TAAGCACAAACCTTTTATCACCATGTGTGTTTTTACAGCACCAATGCATATGTTATAGTATTTGGCAAAAGTTCGCCAGCTCGGCTGGTGGTTTTATTGCAGCGTTACTTCTGTTGGTTGCATTTAGAAGTACTTTGCGTGTTCAGATGGTTTGGACTTGTGCAACGTTATTGTGGTCATCTAATTCAAAGCATTTTTTCTTCGGAGTACGTGTCCTTACTGATTCTTTCAATAACCTTTATAGTTTAGTCTGATATTATGTGAATGTTTGCTTCATATGTTTGTTTTGTGTTTTGCATTTGATTTAAATAGCCTTTTCAAGGTTGGAGATGTTTCATTATCTGCAGAAATAAGTTCATTAGGTTTTGAAGATTGTAAATAGCATCTTTCTAAACAATTAAATGAGTGAATCCCGTTAATATAGTTCAAAATGTTTATTTACTTGTTACAAAATTTGTTTACCTTTTTAATATTTAGCTAACTTATCATCTTTGTTATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32402
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061117 Nonsense 45 978 2 26
Genomic Location (Zv9):
Chromosome 22 (position 25561615)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 25061521
GRCz11 22 25089145
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTCAACATTCTCCATGAAGGAGACATCTTACGAGGAAGCCCTGGCCAAA[C/T]AACGACAAGACTCAGGCAAGACCCAATCCCAACGCTCCGATAAGAAGAAA
Long Flanking Sequence:
TTTCCCCCTTTTTCTTGATGCTGCATTTGTGCATATGTTGCATAACATCTATGTCCTCGGTTGTGAGTCAGTTAGACATAAGCAAAATGACACTCGGAGCTACATGTTAACATTGGGTCTTTTAGGACAAATTATACTTTGTTTTCTGAGATTACTGTCTAAACTTTTCTCTCAATTTCATGTCTACGTCTGAATCTATCGTTGCTTTACTTTAAAAAAAAAAATCTGCTTTCTCTTGATGATTAATGACGAAAATCAAGTCGCAAGCATTGAACTTCAAACAATCTTTTTGCATTTTGGAGATTTCCAAAAGAACCTTTTTTTTCCCCCTTTTAGGATCAGGATTAGGAGGGACAGGAATAAGCAAGATGGATGTGTATGACCCTCAAACCCTGGGAATTGTAGTGTTTGGTGGCTTCATGGTGTTCTCCGCCATTGGCATTACACTTGTCTCAACATTCTCCATGAAGGAGACATCTTACGAGGAAGCCCTGGCCAAA[C/T]AACGACAAGACTCAGGCAAGACCCAATCCCAACGCTCCGATAAGAAGAAAAAGGCATCTGAAAAGAAAACCAAGTCCAAGAAGAAGGAGGAGAAGCAGAATGGGAACCTTCCAGAATCAGAGCCTGAGCCAGAACCTATTCCTGAACCTGTGGTTGAGAACAGTGAGCCCAAAGCAGTACCCCAAGTTGAACCAGAACCCCAACCTGTCGCTGTTCCTGAGCCTGTACCTGAAGTTAAGCCCAAACCAGTTGTATCTGAACCAGTTCCTAACATTGTTGAGTGTGCTGCCCCTCCCACTGTCAGTGCTGTGGTTGCCCCACTTGCTCCTTCCCCAAAGGAGAAGAAAAAGAAGAAGGTGGCCAAGGTAGAACCGGCCCCTGTCAAGCCTGTGGAGGTCCCTATAGTTGTAGCTAAGGTGGAACCAGTGGTTGCTGAGTCGGTGGTGAAAGCAGTAGTTTCCCCTGAGGTTGCTGCTGTGCCTGAAGAACCCAAAGTTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14710
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061117 Nonsense 239 978 3 26
Genomic Location (Zv9):
Chromosome 22 (position 25562303)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 25062209
GRCz11 22 25089833
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTAAAGCRGTTTCTGTGGAGGAGGTTGATATCCCTCAGCCGTCACCATA[T/G]AAGACTCTGGTCTCCAGTCTAAATAGTGCATYGTTCAGTGAGTCYGAGAC
Long Flanking Sequence:
TGAACCAGAACCCCAACCTGTCGCTGTTCCTGAGCCTGTACCTGAAGTTAAGCCCAAACCAGTTGTATCTGAACCAGTTCCTAACATTGTTGAGTGTGCTGCCCCTCCCACTGTCAGTGCTGTGGTTGCCCCACTTGCTCCTTCCCCAAAGGAGAAGAAAAAGAAGAAGGTGGCCAAGGTAGAACCGGCCCCTGTCAAGCCTGTGGAGGTCCCTATAGTTGTAGCTAAGGTGGAACCAGTGGTTGCTGAGTCGGTGGTGAAAGCAGTAGTTTCCCCTGAGGTTGCTGCTGTGCCTGAAGAACCCAAAGTTGAAACTCCAACCAAGAAAAAACCTAAAAAGAAGGCTGAGCCAGGTGAGTCGTCCTATGCTACCCTAATTATGCATTTACTATATAGGACCGTTGTAATAGTAGCTGTTAAAACTTATACTCTTACTAACTGTGGGCTTTTTTTAAAGCGGTTTCTGTGGAGGAGGTTGATATCCCTCAGCCGTCACCATA[T/G]AAGACTCTGGTCTCCAGTCTAAATAGTGCATTGTTCAGTGAGTCCGAGACTCAGAAACTCTTTGAGATCATCAGCAAGAAAGCTGGAAGGGATTCCTGGCAACTGGTACAAAGTCTACAACTAATCAGCCATTGATTTCTGTCTCTTTCTATCATCATCATCACTCTTCTACCATTTCTTTCATTGGCAGGCATCTCAGAAGGGTGACCCACTGGCAACTCTAAAGAAGCAACTGGAGGAGAAGGAGAAGCAGTTGACTGCTGAGCAGGGCAATGTAGCTGCAGCTAAAACGCGTGTTCGAGAACTTACCAAGGTGACACCTGCCTACATGAGTGAACTATTGTCAGCAGAGCGCCACATGTGGTGCTTTGACCAGGGTGCCATCCTTTATCTGACTTTCATTGCTTTGGCCTATAGGAGCTGAATACTGCAAAGAACAAGATAGCATCTACAGAGGCCCGTATGAGCTCTGAGCTGAGCGCCCGTGGTCAGGAGATTAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29801
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061117 Nonsense 418 978 7 26
Genomic Location (Zv9):
Chromosome 22 (position 25563989)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 25063895
GRCz11 22 25091519
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAATCTGTGCACAGGCAAAATGCAGAGTTGGCAAAGTTGCGCCAGGACTG[C/A]GTGCGTCTCAATCGAGAGCTGAAGGAGTGTACAGCCTCTCAGCAGTTTGA
Long Flanking Sequence:
CTTATGTGAGACCGGCAGTAATGCGTCTTGTCTTTATACAGCTTGTCAGAATTTGCCAAGTATGTTTATAATGAGGCAAAATATGCAAGTGAACAGCTCAGTATATTTTATTTTGTAAAATGTCAGAACAGAGCTCAGAGCTCTTTACATTCTAGGGGTTGTTTCTCTGGATATTAATGAGCATATAAAACCATTTTTTGGATAATATTTCAACTAACCATGTTGATTTCAGGGAACAATTTAACATTGAAAAAAAGTGGGAGACACTAACTGAAATCTGACTTTTCATCTACTGATCCCATTCTCATCTCATTCTTCCCCATCAATTCCCTGTTTACTCTTTGCTTCATGTAAATGAAAGTAGCAAAAGTACTCGAATAAAAGATGCACACCAAATCTAATATTGACCTTGCCTCCTGGCATGCAATGTCGTATCTGTTTATTTTCTGTGAATCTGTGCACAGGCAAAATGCAGAGTTGGCAAAGTTGCGCCAGGACTG[C/A]GTGCGTCTCAATCGAGAGCTGAAGGAGTGTACAGCCTCTCAGCAGTTTGAGGAAGAGCGAAGGAAGAGTCTTGAAACAAAGTTGGCGGCTGCTGAAGAACAGTTAAAACAAACACAGGTAAAACCCGACCTCTTTACTGTTATCTCCTCTTTCTGAAGTGGTTGTGGTCTTTGTACCATGTCAGTTCTAGATACCAATTTCACCATTTTACAGTCTTTAAAATCAATGCCTTTATCTGTCTTTTAAGATAGCTTTTATTCCACTCTTAGCACATTTCTGTCTGTTTGTGCATGCTGTTTTGTGGGTTTGTATTTGCGCTTTTTTGTAGTTGTAGTTGTAACTTTATTGTCCTTGACAGGAAATTTGTTATGGGCATCGCCATTTTGCTGCAGACATTCAATAAAAACAATACAAAATACAGCAGTTACAAAATTTAAATAATTAAAATATACTAGTACGTTTAAAAAGTAACTACACAAAAACGTCAGCAGCAACATGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa797
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061117 Nonsense 438 978 7 26
Genomic Location (Zv9):
Chromosome 22 (position 25564047)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 25063953
GRCz11 22 25091577
KASP Assay ID:
554-0702.1 (used for ordering genotyping assays)
KASP Sequence:
TCAATCGAGAGCTGAAGGAGYGTACAGCCWCTCAGCAGTYTGAGGAAGAG[C/T]GAAGGAAGAGTCTTGAAACMAAGTTGGCGGCTGCTGAAGAACAGTTAAAA
Long Flanking Sequence:
AGTATGTTTATAATGAGGCAAAATATGCAAGTGAACAGCTCAGTATATTTTATTTTGTAAAATGTCAGAACAGAGCTCAGAGCTCTTTACATTCTAGGGGTTGTTTCTCTGGATATTAATGAGCATATAAAACCATTTTTTGGATAATATTTCAACTAACCATGTTGATTTCAGGGAACAATTTAACATTGAAAAAAAGTGGGAGACACTAACTGAAATCTGACTTTTCATCTACTGATCCCATTCTCATCTCATTCTTCCCCATCAATTCCCTGTTTACTCTTTGCTTCATGTAAATGAAAGTAGCAAAAGTACTCGAATAAAAGATGCACACCAAATCTAATATTGACCTTGCCTCCTGGCATGCAATGTCGTATCTGTTTATTTTCTGTGAATCTGTGCACAGGCAAAATGCAGAGTTGGCAAAGTTGCGCCAGGACTGCGTGCGTCTCAATCGAGAGCTGAAGGAGTGTACAGCCTCTCAGCAGTTTGAGGAAGAG[C/T]GAAGGAAGAGTCTTGAAACAAAGTTGGCGGCTGCTGAAGAACAGTTAAAACAAACACAGGTAAAACCCGACCTCTTTACTGTTATCTCCTCTTTCTGAAGTGGTTGTGGTCTTTGTACCATGTCAGTTCTAGATACCAATTTCACCATTTTACAGTCTTTAAAATCAATGCCTTTATCTGTCTTTTAAGATAGCTTTTATTCCACTCTTAGCACATTTCTGTCTGTTTGTGCATGCTGTTTTGTGGGTTTGTATTTGCGCTTTTTTGTAGTTGTAGTTGTAACTTTATTGTCCTTGACAGGAAATTTGTTATGGGCATCGCCATTTTGCTGCAGACATTCAATAAAAACAATACAAAATACAGCAGTTACAAAATTTAAATAATTAAAATATACTAGTACGTTTAAAAAGTAACTACACAAAAACGTCAGCAGCAACATGTGCCCGTGTCACCAGCAGTGCAGCACCACCGGAAGTGAGCCCGCTTTCTAGTACAGGTTA
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461