Busch Lab

ZMP

rfx6

Ensembl ID:
ENSDARG00000041702
ZFIN ID:
ZDB-GENE-041014-299
Description:
DNA-binding protein RFX6 [Source:UniProtKB/Swiss-Prot;Acc:Q5RJA1]
Human Orthologue:
RFX6
Human Description:
regulatory factor X, 6 [Source:HGNC Symbol;Acc:21478]
Mouse Orthologue:
Rfx6
Mouse Description:
regulatory factor X, 6 Gene [Source:MGI Symbol;Acc:MGI:2445208]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa17912 Nonsense Available for shipment Available now
sa18622 Essential Splice Site Available for shipment Available now
sa23789 Nonsense Available for shipment Available now
sa29438 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa17912
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061122 Nonsense 35 848 1 18
ENSDART00000132310 Nonsense 28 841 1 18
Genomic Location (Zv9):
Chromosome 20 (position 42565782)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 42636941
GRCz11 20 42534051
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGAAGAAGACCTGGGCCATCTGGATTATTCCAAGYCATTCGCTGCRAAA[C/T]AAACGCAGCCAAAGAAAAGCATCAGTCAGATCATCAAGGACAAGAAGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18622
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061122 Essential Splice Site 121 848 3 18
ENSDART00000132310 Essential Splice Site 114 841 3 18
Genomic Location (Zv9):
Chromosome 20 (position 42563434)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 42634593
GRCz11 20 42531703
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
NNAATTTCCTCTTCTWACAACAMGAAGGCTTGGAACCAGAGGCCATTCAAA[G/A]TAAGATAGGCCAGGTTTCTGACTCAAAAACATCATTTAGTGCTTTTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23789
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061122 Nonsense 318 848 10 18
ENSDART00000132310 Nonsense 311 841 10 18
Genomic Location (Zv9):
Chromosome 20 (position 42557376)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 42628535
GRCz11 20 42525645
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGAGAAGAAAGTGCCGATAGCAAGACGATTTGTGTCGTCCTTAAAGAGA[C/T]AGACCTCATTTTTACATCTCGCACAGGTACAGACACTTCTATAATTCTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29438
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061122 Essential Splice Site 720 848 17 18
ENSDART00000132310 Essential Splice Site 713 841 17 18
Genomic Location (Zv9):
Chromosome 20 (position 42540932)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 42612091
GRCz11 20 42509201
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTTTGCAGATGCTCCTATTGAAACTTTAACATTCATCTTTCTTCTGTCC[A/T]GGATATTACGGCAGCAGCAGTGGTTATGTGGATGCTCCGAGGATGGGCAC
Associated Phenotype:
Not determined