Busch Lab

ZMP

slc24a1

Ensembl ID:
ENSDARG00000041431
ZFIN ID:
ZDB-GENE-060503-191
Description:
Novel protein similar to solute carrier family 24 (Sodium/potassium/calcium exchanger), member 1 (SL
Human Orthologue:
SLC24A1
Human Description:
solute carrier family 24 (sodium/potassium/calcium exchanger), member 1 [Source:HGNC Symbol;Acc:1097
Mouse Orthologue:
Slc24a1
Mouse Description:
solute carrier family 24 (sodium/potassium/calcium exchanger), member 1 Gene [Source:MGI Symbol;Acc:

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa18070 Nonsense Available for shipment Available now
sa29018 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa43082 Nonsense Mutation detected in F1 DNA Not yet available
sa36625 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa18070
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060735 Nonsense 270 724 1 9
ENSDART00000135729 None None 205 None 4
ENSDART00000139601 Nonsense 121 197 1 1
ENSDART00000140447 None None 36 None 1
Genomic Location (Zv9):
Chromosome 18 (position 18790230)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 19020453
GRCz11 18 19009519
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTAATTGGAAWGTGTGCAYTGTTTTCACGCRARATGCTTCACCTCACCTG[G/A]TGGCCTCTCTTTCGGGAYGTGTCCTTCTATATCCTGGATCTCATCATGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29018
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060735 Essential Splice Site 347 724 2 9
ENSDART00000135729 None None 205 None 4
ENSDART00000139601 None None 197 None 1
ENSDART00000140447 None None 36 None 1
Genomic Location (Zv9):
Chromosome 18 (position 18796191)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 19026414
GRCz11 18 19015480
KASP Assay ID:
2261-2076.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATTCTCTGAATATTTTGCATACTCTGTAATTCTAAATGGTGTTGCACAC[A/T]GGATAATGGAACCTCAGGTGAAGAGAACAGGCCACCTGAACCAGAAGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43082
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060735 Nonsense 442 724 5 9
ENSDART00000135729 None None 205 None 4
ENSDART00000139601 None None 197 None 1
ENSDART00000140447 None None 36 None 1
Genomic Location (Zv9):
Chromosome 18 (position 18804037)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 19034260
GRCz11 18 19023326
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTATCATGGTTTAAATAAGGTGATGATCAATCGGAGCAGACCAAGGATT[C/A]AAAAGACGCGCCTCCAGGAGCCAAAGATGAAGACACCAATCAGAAGTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36625
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060735 Essential Splice Site 556 724 None 9
ENSDART00000135729 Essential Splice Site 37 205 None 4
ENSDART00000139601 None None 197 None 1
ENSDART00000140447 None None 36 None 1
Genomic Location (Zv9):
Chromosome 18 (position 18815239)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 19045462
GRCz11 18 19034528
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCCCATTGTCTTTCCACTGTGGCTGACCGTTCCAGATGTCAGAAACCCTG[T/A]GAGAACCAAAACCAAATCACTTCAGCTTTAATTTTATTTGTTCTTCTTTT
Associated Phenotype:
Not determined