Busch Lab

ZMP

ttk

Ensembl ID:
ENSDARG00000041361
ZFIN ID:
ZDB-GENE-030123-1
Description:
Dual specificity protein kinase Ttk [Source:UniProtKB/Swiss-Prot;Acc:Q8AYG3]
Human Orthologue:
TTK
Human Description:
TTK protein kinase [Source:HGNC Symbol;Acc:12401]
Mouse Orthologue:
Ttk
Mouse Description:
Ttk protein kinase Gene [Source:MGI Symbol;Acc:MGI:1194921]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa11341 Essential Splice Site Available for shipment Available now
sa18112 Nonsense Available for shipment Available now
sa42649 Nonsense Mutation detected in F1 DNA Not yet available
sa25000 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa11341
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060630 Essential Splice Site 29 982 2 25
ENSDART00000131876 Essential Splice Site 29 983 2 25
ENSDART00000138654 None None 160 None 5
Genomic Location (Zv9):
Chromosome 16 (position 6375630)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 5241924
GRCz11 16 5141550
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGCCATGCTGTGTCAAAAGCTGGCCATGATGAAGCAATTGTTCAATGAAG[G/A]TAATCGATTTATTAATTAGTTTNTTTTCAGRATTCCTAATGTAGGATTCCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28575
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060630 Essential Splice Site 104 982 3 25
ENSDART00000131876 Essential Splice Site 104 983 3 25
ENSDART00000138654 None None 160 None 5
Genomic Location (Zv9):
Chromosome 16 (position 6375220)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 5241514
GRCz11 16 5141140
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGAACGAGAGCTACGCCAAGATGCTGGTCAGATTTGCAGAGTTAAAAGC[G/A]TAAGTCACTTCCATTTCCTGTTTGACTTGCTTTAGCAATCATTTATAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18112
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060630 Nonsense 587 982 15 25
ENSDART00000131876 Nonsense 588 983 15 25
ENSDART00000138654 None None 160 None 5
Genomic Location (Zv9):
Chromosome 16 (position 6358571)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 5224865
GRCz11 16 5124491
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CACCTCTTCGATTAAACCCCTCACTCAGCTGTCAGACGCCCAACTACAGA[C/T]AGCCAAATCCTAACAGGTGATGAGARCACAGATAAAYATGTGGATTAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42649
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060630 Nonsense 615 982 16 25
ENSDART00000131876 Nonsense 616 983 16 25
ENSDART00000138654 None None 160 None 5
Genomic Location (Zv9):
Chromosome 16 (position 6358000)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 5224294
GRCz11 16 5123920
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGCAGCGGCCTGTGATTGTGTCTGTTCCAGCGACGGCTCAGAAAATGTG[T/A]CCGACTGCGCTGCCCTGCACGCCTCAGAGCGGTGTGTCCTACATCCAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25000
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060630 Nonsense 961 982 25 25
ENSDART00000131876 Nonsense 962 983 25 25
ENSDART00000138654 Nonsense 139 160 5 5
Genomic Location (Zv9):
Chromosome 16 (position 6344817)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 5211111
GRCz11 16 5110737
KASP Assay ID:
554-7798.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACATCGTTAACCTTTAGCCTCTGTCTCTGCAGAATTTAGCCATGATGTG[C/A]AACAGCGGGAGGAAACTGGATGTTTCTGAATGTGTGAAAAGCTCCAGTCA
Associated Phenotype:
Not determined