Busch Lab

ZMP

zgc:161969

Ensembl ID:
ENSDARG00000041359
ZFIN IDs:
ZDB-GENE-030131-2597, ZDB-GENE-030131-2597
Description:
hypothetical protein LOC569044 [Source:RefSeq peptide;Acc:NP_001077318]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa33835 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa33835
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109151 Essential Splice Site 56 630 1 2
ENSDART00000114667 Essential Splice Site 56 717 1 3
Genomic Location (Zv9):
Chromosome 6 (position 16386955)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 16342213
GRCz11 6 16469153
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTGTCCACCGCAAGGGACTCCACGTCTAATCTGAAGAAGCATTTAGAGG[T/C]ACTTTTGCACGTTTTCTCAAATCCATATCTAATGATTGCAGCTTTTATTG
Long Flanking Sequence:
ATTACTAAAGTATGATTTAATATGGGGGAAAACTGTTTTCTGCCAAAAGATGGCGGTAATGAGCAACTTTGGTCTATCCTCCGCCAAACCAGCAAAGGGGAAAGAGAAGAAAAACGTTTCACAGGAAATGCGCCTCTGTTGTTTGGTAGTAACGGACTACTCGATATTTGGATTACGTAATTAGATTACAAAAATCTAGAGTCTGCATCTGGAATAGGATATATTCTATTTATTTATTTATTACACTATTAAATAGTACTAAGCGAACGCAATTTACTGTGTTTGTTCCTACGTTTTTAAAGCGCTGTCCAGACCGGAGCCTCGTGTGAAGATGGAGAGATCTCGTACAGCTTTTGACCACTGGATGCACAAACACTACTTCACGTACAGGGATACAAGAGGAAGAAACATTACTGTTCAGTGCAACCTCTGCCTCCCGAAGATCAACATCTTGTCCACCGCAAGGGACTCCACGTCTAATCTGAAGAAGCATTTAGAGG[T/C]ACTTTTGCACGTTTTCTCAAATCCATATCTAATGATTGCAGCTTTTATTGTGTATTTTGAGTTTGAGGGGCCAACATTACTGCGCAAAAGTAGACTGTTTTTGGATTCCCTGGTGGGTCCCAGCCACATACTTTTGCCACACTCCTAAATTTGAGCAAAAGCAAACAACATGTAATGTATAACCAATGCAAATTAGTGACTAATAAACGCAAGTAGGCGCTGGTTTTTAGTTGAACTGTTTTTCAGGGTAAGTTTGGAGCGAAACGTGGGCAAATAATCAACAAAAGTGGGAGTGGTTTTGAGTTCAGAGCAAACTTAATTTCTTCTGTAAATGTAAAAAGTTTGATCGTAGTTAAATTAAGTCTAGTTTTCGCCTAGTAATAACAACATAAAGCTCTTCATTTATATTTTTGTATGTTATCTTAAATATTTTGCTTTAGATAAGGTTTGCAGAATACTTTCTTACGTTTAAACAATGCATTTACTATTGTTCTGCGAAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1819
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109151 None None 630 None 2
ENSDART00000114667 Missense 130 717 2 3
Genomic Location (Zv9):
Chromosome 6 (position 16390223)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 16345481
GRCz11 6 16472421
KASP Assay ID:
554-1811.1 (used for ordering genotyping assays)
KASP Sequence:
CGGAAAAAAGTGTCGGCACGTTCGGGCAACACTTCAAACATGCAGCACCA[T/A]CTTCGTGACCACCACCCCATGGAATTTGCAAAGCTCAATGTAAGTGAACA
Long Flanking Sequence:
GTGTGCACTTGACAGTCTTCAACATGATTTTACACGCTAAATAAAGCATTATAAAAGGATTGGGGCAACATGCAAGTTTGTAATAGTATGTTTTTGTTCCAAGCAAAGTAATGGTATGATGGTTTTATGGTACACTGTTTTAAATACAGGCGGTTTTGATTTTACAACAGGTTATTGTAACATTCTAACAAGTTAGAGTTTATAAAAAAAAAACTATACATTTAATTTAAGAGAGAATCATAAATGTCTAAATTGCGCCTTTCTCCTCTTTTATTTAAGTGTCACTCACCTCACCTGATGCGCAAACACCAGCACATCGAAATGTCGGAGCCTGAGCCTCTTTTTCTCCCACCCAAGCGGCTGAAATCCGCAGTCTGGGAGTATTTTGGGTATTATAAAGACCCAGGAGGCACCATCATTGCTGATGGTCGTCCAGTTTGTAGAATGTGTCGGAAAAAAGTGTCGGCACGTTCGGGCAACACTTCAAACATGCAGCACCA[T/A]CTTCGTGACCACCACCCCATGGAATTTGCAAAGCTCAATGTAAGTGAACATGTTATGAAACGCCAGCTAATAAATTGTAGATCGCCTTTTATAAAACACATACGCAAACTAAATGCACTTCCGCAAGATTTATATTAACTTAATTGCGTAAGAAAGGTGAACTTTGCTTGTGTTTTCTGTAAGCTCCTAATACATCTATAGCCCAACTGTTAATTAGTACAAATAAAATAGAAAATACTGTGTGAAATAAATCATGTTTGATTATAGCGATTTCAGTGTACCATAAACATCTCATACCGTTACGCTTCTTGTACAGCTTGCTTGAAAACTTTTGCCCTACTTTCTACAAGTAATTGTATTTAAAAAAAATGCAATAATTTCCTCATACTTAAATTGTTCCAAACCTAAATATGCTACTTAAAGAAAATTATTAAAATAGGGGTGATAGGGAACTCATTTTAGGGCTGCACAATATATAAATGTTTTTGTGATAATAGTAT
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461