Busch Lab

ZMP

cyp19a1a

Ensembl ID:
ENSDARG00000041348
ZFIN ID:
ZDB-GENE-990415-43
Description:
Cytochrome P450 19A1a [Source:UniProtKB/Swiss-Prot;Acc:O42145]
Human Orthologue:
CYP19A1
Human Description:
cytochrome P450, family 19, subfamily A, polypeptide 1 [Source:HGNC Symbol;Acc:2594]
Mouse Orthologue:
Cyp19a1
Mouse Description:
cytochrome P450, family 19, subfamily a, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:88587]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa7241 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa7241
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124001 Essential Splice Site 247 481 6 9
ENSDART00000129828 None 282 517 6 9
Genomic Location (Zv9):
Chromosome 18 (position 38061678)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 39643381
GRCz11 18 39624389
KASP Assay ID:
554-5262.1 (used for ordering genotyping assays)
KASP Sequence:
TGTTTTAGTCAGGAGTTGCAGGATGCCATCACAGCTCTGATCGAGCAGAA[G/A]AAAGTTCAACTGGYACACGCAGAGAAACTYGACCACCTCGACTTTACAGC
Associated Phenotype:
Not determined