Busch Lab

ZMP

stx8

Ensembl ID:
ENSDARG00000041311
ZFIN ID:
ZDB-GENE-040426-1360
Description:
syntaxin-8 [Source:RefSeq peptide;Acc:NP_956669]
Human Orthologue:
STX8
Human Description:
syntaxin 8 [Source:HGNC Symbol;Acc:11443]
Mouse Orthologue:
Stx8
Mouse Description:
syntaxin 8 Gene [Source:MGI Symbol;Acc:MGI:1890156]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa13970 Nonsense Available for shipment Available now
sa44633 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8226
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060547 Essential Splice Site 150 235 5 8
ENSDART00000146442 None None 54 None 2
ENSDART00000060547 Essential Splice Site 150 235 5 8
ENSDART00000146442 None None 54 None 2
Genomic Location (Zv9):
Chromosome 6 (position 18209971)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 23244311
GRCz11 6 19715632
KASP Assay ID:
2259-7379.1 (used for ordering genotyping assays)
KASP Sequence:
AGGACTAAGCTTTGGAGAAATCAAAAACCAACAACAGCAGATTATCGAAG[G/T]TACATTGCATACAGTTTGAGTTTACTCTGCCGGTCTATCAAGTTTATTAT
Long Flanking Sequence:
TAATATTTTTAAACTAGAACTGTTTCTAACATAAACCCCAATCATTTCTTTTGCAGCTATAAGATATAAGCTACTGCTTTTTTGTATTGTTTTCCACTGTCACCTTTAATGTTCATATGAAAACCGTGTAAGTTTATTTTACATTATTAGTTTGAAACATTTGAAAATTACCCTCCTTTAAAAAAAAATGTTAGAAATGGAAAAAAATAAATAAATAAACAATAAATAAATGTATCTTCTGCTTCTTATTCCATCAAAATGTCAGGTTTAAACTAGGAAAATTTAAATAAAATAAATAAAAAAAAGAAAGAAAAAAGAAACAAAATGGAAGATGAAATTGAAATGTTACAATATGTTGATCTTTATCTTCAGGTCAACTCTGATGGCAGGTGGAAATGGGTCTGGATCTGCAGTGAATCCGTGGCTTATTAATGAATCTGAGGAGACCAAAGGACTAAGCTTTGGAGAAATCAAAAACCAACAACAGCAGATTATCGAAG[G/T]TACATTGCATACAGTTTGAGTTTACTCTGCCGGTCTATCAAGTTTATTATGTAGCCTAAAGGATTAGTTTACCCAAATAGGAGAAATATATGAATCACCCTCATGTCATTATAAACCCTTGAGACAATAATTCATCTTAGGAACACATATTAACATATTTATATGAAATCTGACAGCTCCTTTATCTTCCTGTGACAGCAAAGTTCCTGACTCATTCAAAGTCCAGAAAAATACCTAGAATATTCTCTAAACAAACCAAATGCCTTTAGTGGTTGAATAGGAACATTATCAAGCTACAATACTTTCATTTGTACATAAAACTACGTTTTATTCAACATTTTTTTTCCCTCAATGTCAGTATAAGGCACAGGGTGAACACTGTGTAGTGATGTAAACGCCGCCCATTCCTGTAACTTTGTTTGGAACAAAGCACAAGTTTATTCTCCAAGGCATGACCAAGCATGAGACATGAACGTGTGCCCTATACTGACACTGAAGAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa18838
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060547 Essential Splice Site 150 235 5 8
ENSDART00000146442 None None 54 None 2
ENSDART00000060547 Essential Splice Site 150 235 5 8
ENSDART00000146442 None None 54 None 2
Genomic Location (Zv9):
Chromosome 6 (position 18209971)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 23244311
GRCz11 6 19715632
KASP Assay ID:
2259-7379.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGACTAAGCTTTGGAGAAATCAAAAACCAACAACAGCAGATTATCGAAG[G/T]TACATTGCATACAGTTTGAGTTTACTCTGCCGGTCTATCAAGTTTATTAT
Long Flanking Sequence:
TAATATTTTTAAACTAGAACTGTTTCTAACATAAACCCCAATCATTTCTTTTGCAGCTATAAGATATAAGCTACTGCTTTTTTGTATTGTTTTCCACTGTCACCTTTAATGTTCATATGAAAACCGTGTAAGTTTATTTTACATTATTAGTTTGAAACATTTGAAAATTACCCTCCTTTAAAAAAAAATGTTAGAAATGGAAAAAAATAAATAAATAAACAATAAATAAATGTATCTTCTGCTTCTTATTCCATCAAAATGTCAGGTTTAAACTAGGAAAATTTAAATAAAATAAATAAAAAAAAGAAAGAAAAAAGAAACAAAATGGAAGATGAAATTGAAATGTTACAATATGTTGATCTTTATCTTCAGGTCAACTCTGATGGCAGGTGGAAATGGGTCTGGATCTGCAGTGAATCCGTGGCTTATTAATGAATCTGAGGAGACCAAAGGACTAAGCTTTGGAGAAATCAAAAACCAACAACAGCAGATTATCGAAG[G/T]TACATTGCATACAGTTTGAGTTTACTCTGCCGGTCTATCAAGTTTATTATGTAGCCTAAAGGATTAGTTTACCCAAATAGGAGAAATATATGAATCACCCTCATGTCATTATAAACCCTTGAGACAATAATTCATCTTAGGAACACATATTAACATATTTATATGAAATCTGACAGCTCCTTTATCTTCCTGTGACAGCAAAGTTCCTGACTCATTCAAAGTCCAGAAAAATACCTAGAATATTCTCTAAACAAACCAAATGCCTTTAGTGGTTGAATAGGAACATTATCAAGCTACAATACTTTCATTTGTACATAAAACTACGTTTTATTCAACATTTTTTTTCCCTCAATGTCAGTATAAGGCACAGGGTGAACACTGTGTAGTGATGTAAACGCCGCCCATTCCTGTAACTTTGTTTGGAACAAAGCACAAGTTTATTCTCCAAGGCATGACCAAGCATGAGACATGAACGTGTGCCCTATACTGACACTGAAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13970
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060547 Nonsense 180 235 6 8
ENSDART00000146442 None None 54 None 2
Genomic Location (Zv9):
Chromosome 6 (position 18207481)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 23246801
GRCz11 6 19718122
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TAAGTAGACAAAAACAGATGGGTCAAGAAATCGGCAATGAGCTWGATGAA[C/T]AAAACGGTGAGTGAAAAGTGCAGTAGCCTATATATGACAGGTCTGGCTGA
Long Flanking Sequence:
ACTTGTGGTGGATGAGAAGATTCCCCCCAAAAATGTGTAAAGCGCTTTGAGTGTCCAGAAAAGTGCTATGTAAATGTCAGGGATTATTATTATTATTATTATTATTATTATTATTATTATTATTATTATAAATAACAGGGTTTTAAAACGTGTTAAGCATGTTCTTTATTAAATTAATTTTTTGTTAAAAATAATATAACCAACTGCTAAAATTGATTTATGTTTCTGCAGTGTAAATATAAGCATTATAAATGGGATTTGCACGTAGTACTATACACAATGTTGTCATTATTATATGTGTGCATCAGTTGTGTCACTTCTCTGTCATTCATAATTCTTTGCCCTTTTGTTTTTGTGTGGTTTACATATTTTGTCTGAATATACCTCTGTCCTCTTTTGTGTCTTGCTCTTTAGCCCAGGATGCTGGCCTGGATGCTCTGGCGTCAGTCTTAAGTAGACAAAAACAGATGGGTCAAGAAATCGGCAATGAGCTAGATGAA[C/T]AAAACGGTGAGTGAAAAGTGCAGTAGCCTATATATGACAGGTCTGGCTGAACATCCACATGTTTTTCTATGAATAACGTCTAATTTGTGGTCAGGTTGGTTTTACTTTGTCACGCTGCTCTATCGCTAAACTACATATGATGTCATTGGCTTTAAAATGAGCATTTTTTTCCAGTGGAAAATGTGGAATGGTACATGGAAACTCTCACCTGGTCTATCACATTTTTAAACTTCTTCCCAATGCAATGTTTCAAACTTATTTTATAAACATAAGACATCGCACAGAGACATCACATCATTGTAGTGAATCTATTTGAGTTGGAATGTGAGAACATGGAGGAATCACATAGTATGTACATGGAGTAGACTGAGCACAGGTCAGTCATCTGTGACCTCATCTGAAGGTCACAGGTGCTTTTAACTTTTCCCACACGGCCTTTCCAACCTTTTAATGCTGGAGTGGTGAAAACAGATAGACTTATATACAGATATATATAATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44633
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060547 Essential Splice Site 216 235 None 8
ENSDART00000146442 Essential Splice Site 35 54 None 2
Genomic Location (Zv9):
Chromosome 6 (position 18123658)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 23330624
GRCz11 6 19801945
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAAGAGTGTCCTTTATTCATTAAGATGTTTTGTGTGTGTGTTTGATTTC[A/G]GGCATGATGGTGGTGATTGTTCTTCTTCTAATCGCCATCATTGTTGTGGC
Long Flanking Sequence:
TGCTGTTCTTGCACTATTGCACAATACAATTGATTGGGACAGAATAATAATAATTATGCCTATTATTTGTAGTATTTTCATAGTGATTTAAACTACCTCTTCAATATGCACATCAAGAAACAAAAAGCTAGTTTTTACTGCATATAGTTTGTGGAAGAATGACTGAGTGTGTTTATCGCTCGCTCGACCGTACACACACCCACAGATATATTTCAGCAGTTGTGTGGCTCGATAAACATGCTGATTTGCATCATCACTGATGACAGGTAATGCTTGAAATATAAACGTCATGTCTGTTATCTTAAGATACATCACTTATGTCAGGTTTCCACTTTTTTCTTGTGCTTGAAAGTTAAAACAGCCCTGCTATGAATTGTCAGTCACTGAAATGGCCCCCCACCAATTTGAGTCCCCTGGTTTAGAAGAAAGTGTCTGGTGCATATGGAAAGGAAAAGAGTGTCCTTTATTCATTAAGATGTTTTGTGTGTGTGTTTGATTTC[A/G]GGCATGATGGTGGTGATTGTTCTTCTTCTAATCGCCATCATTGTTGTGGCCTGTTGGCAGTAATGAAGAAGATGAAGATGCCACAGATATGAACTATAGAGACTTTCTGTCTGTATATAGTGGTGAGTGATGGATTCACGCAGTATCCGAACAGACTGGACATGTAATCACATCTCTGCACACAGCTCTCTTTTTTCTCGTACAGTAATGGAACACATAACTGGGTTAAAGCCAAGAAATGGACCACTATGAAGAACTGAATTCTTAGCTCCACAGATAACGATCAAAGTAGGATTCGGAATGGAAAGAAAAATAGAAAAGAGCTTTGAAAGGTTTTGAATATTATTATGAATAAAACCATGAGCCCAAGATGCTCCAAGGGGGGAAACTATTTAAATTCTTTGTTTGGCAGTGAAGAAAATGATCCGTATCCATCGTGTAAACAGGGACTGAGTCACAAAGCAATACCGAGTTTTGAGCTCTACTGTTGGGGTAAATAG
Associated Phenotype:
Not determined