Busch Lab

ZMP

si:ch73-138e9.2

Ensembl ID:
ENSDARG00000041304
ZFIN ID:
ZDB-GENE-100922-182
Human Orthologue:
TRAK1
Human Description:
trafficking protein, kinesin binding 1 [Source:HGNC Symbol;Acc:29947]
Mouse Orthologue:
Trak1
Mouse Description:
trafficking protein, kinesin binding 1 Gene [Source:MGI Symbol;Acc:MGI:1914345]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa22744 Nonsense Available for shipment Available now
sa2869 Nonsense F2 line generated Not yet available

Mutation Details

Allele Name:
sa22744
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085678 Nonsense 43 911 1 18
ENSDART00000136936 None None 860 2 16

The following transcripts of ENSDARG00000041304 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 7107335)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 5951866
GRCz11 16 5851492
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACTATAAGCTGAGAGCCGACACTATATACGGCTATGATCACGACGACTG[G/A]CTCCACACGCCTCTCATCTCCCCCGACGTCAACCTCGACCTGACCACTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2869
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085678 Nonsense 439 911 11 18
ENSDART00000136936 Nonsense 361 860 12 16

The following transcripts of ENSDARG00000041304 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 7064604)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 5909135
GRCz11 16 5808761
KASP Assay ID:
554-3194.1 (used for ordering genotyping assays)
KASP Sequence:
CAGCATGTAYGGTGGAGACGGYRTGGAGATAGACAACCGCACTAACAGTT[T/A]ACTGCTGGAAACACAGTCTCCWCAGGATGGGTAAGAGAATCCAACRGCAT
Associated Phenotype:
Not determined