Busch Lab

ZMP

noxo1

Ensembl ID:
ENSDARG00000041294
ZFIN IDs:
ZDB-GENE-030131-9700, ZDB-GENE-060929-852
Description:
hypothetical protein LOC572245 [Source:RefSeq peptide;Acc:NP_001071052]
Human Orthologue:
NOXO1
Human Description:
NADPH oxidase organizer 1 [Source:HGNC Symbol;Acc:19404]
Mouse Orthologue:
Noxo1
Mouse Description:
NADPH oxidase organizer 1 Gene [Source:MGI Symbol;Acc:MGI:1919143]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa26180 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa26180
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090370 Essential Splice Site 76 472 3 8
ENSDART00000129876 Essential Splice Site 74 383 3 10
Genomic Location (Zv9):
Chromosome 3 (position 62825404)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 61926509
GRCz11 3 62163139
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCATCAAACCCCTTTAAGCGATCAGCACGGATTGTTCCCGAATTTAAAG[G/A]TAGAAAGTTTTTCTGTTGCTTTTTCTGTTGTTTTCTTTGAGTATTAAAGG
Long Flanking Sequence:
TTAATTAATTTTATCACAATTAATAAGAGTTATGTGTTACTGTAGGGAAGTGTATTCAAATATTCAAAGAAGCCATGCATTCAGGGATTTTTTCACTTGTTTTCTTGTGATCTTGATGTAACAAAAAAAAAAATGTTTTCTCATTATCAAGACCTAATTTTTTTGCTTTTATTTATTTGTGTATTTATTATTATTTATTCATTATTATTTATTTATTAAGGAAACAAGTTTAATATGTTCAGGTAATGAAAATATTAAGTTGTGATCATGAAAAAACAAGAAAAAAAATATATAATGCTTCTGTAATATTGACTTTAATTCAGTTCAGTAACAATTGCATTTATCTGAGCTATTTTTATTGTAGAGAAGTAATATTAATATTGGCTTTAATTCAGTATAGTAAGATTTGCATGTGTGTTTTCTGCAGAGACAACTCAAGAAGAAATTCCCTCCATCAAACCCCTTTAAGCGATCAGCACGGATTGTTCCCGAATTTAAAG[G/A]TAGAAAGTTTTTCTGTTGCTTTTTCTGTTGTTTTCTTTGAGTATTAAAGGGTCAGTTCACACAAAAATAAACATGTACTCACTATTTATTCTCCGTCAAGTGGTTATGTATAAGTTTTGATACCTTTTGAATGTGTGTATATAAGCATCTTAAGCATATTTAATAGAAAACATATGCGTGTGTAAATATATTTATTTTGTATTTTATTTATTTGTGTGTTTATATATATATATATATATATATATATATATATATATATATATATATATGCATGATGCATTATGAAAATACTAACTTTTGGATGCTATTAATTGTTTGAGAGCGCTATTATATGAATATTTATATGTGCATATTTGCTGTATGTGCAGAAGTGCGAGTGCAGAAGAGCCTGCAGAAGTGGAGCGGCAGTAAATCAGTGCTGCGGATGAAGGCTCTGGAGGAATACTGCGGTCAACTGCTGAAGAGTGACGCGCAGGTCTGCCGCAGCTCAGAGCTCATAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8150
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090370 Nonsense 290 472 8 8
ENSDART00000129876 Nonsense 286 383 9 10
Genomic Location (Zv9):
Chromosome 3 (position 62829209)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 61930314
GRCz11 3 62166944
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTACTCTCAGGTACAACCGAAAGGCGGGATACGTCCCAYCCATGTACCTA[C/T]AGCCGCACAACAACCCTCGGATTCTCTTGAAGTCCACTCAGAAGGAGATA
Long Flanking Sequence:
TCGAGTATTTCCCAAATGATGTTGAATTTCTCTCAGTGTTTCCTCTAATGTCTGTTCTTCTGGAGAAAGTCTGATGTGTTTTATTTGTGCTAGAATAACAGCAGTGTTTAATAGTGTTAAAGTCATGTTAAGCTCAATATTATTCACCCCTTCAGCAATATTAGTGATGGATTGTGTCCAGAATAAACCACTGATATACAATGACTTGCCTAATTACCCTAACTTTACCCTAACTACCCTAGTGAAGCCTTTACATGTCACACATGTCAAGCTGTATACTAGTGACACAATAAATGCGCAATATAAATACACATTACATGATATAATCGAAAAAAAAAAATCATCAACAGATTAATGGATTATTAAAATAATCGTTAGTTGCAGCCCTACAATATTATGCATGCTCTTCATCACGATGTATTTCATATTTACTAAAATATGATCATATCTCTACTCTCAGGTACAACCGAAAGGCGGGATACGTCCCATCCATGTACCTA[C/T]AGCCGCACAACAACCCTCGGATTCTCTTGAAGTCCACTCAGAAGGAGATATCCCGCTCTACTCTTGATCTGGCACAACTCCAGCATCCCCAAACCCTGCAGGACTCCAGACTGCGAGAGCTCAGCAGATCTCAAGGAAACCTGCTGCTGCAGCCTGCAGAAACCGACATCATGGATAAACAGAAGTCACGTTCGCTGGGAAGACTTCCAGACGCGGCGAGAGCAAACCCTCCGTCGATCCGGGTGGAGTTTGCGGAGAGCGGGAAACAGAGCAGTCAGAGTGACGACAGCGAGGAGTTCAGCGATGACAGCAGCTTTTCCTGCAGCGATTCGCTCGACCGCTCAGACGCAGAGGAGTGTTTCCGGCGGAGTCGCACGCCGACTGCTGAAACTCTAACTCCTGAGAGCGCAGGAGGGATTACGGCTAGCAGATCAGACCCATGTCTTAATAAAATGCCGTCCACTCCGAAAGTGCCGCCCAGACCCGCCGTGCAGGAGATC
Associated Phenotype:
Not determined