Busch Lab

ZMP

alg12

Ensembl ID:
ENSDARG00000041199
ZFIN ID:
ZDB-GENE-041210-295
Description:
dolichyl-P-Man:Man(7)GlcNAc(2)-PP-dolichyl-alpha-1, 6-mannosyltransferase [Source:RefSeq peptide;Ac
Human Orthologue:
ALG12
Human Description:
asparagine-linked glycosylation 12, alpha-1,6-mannosyltransferase homolog (S. cerevisiae) [Source:HG
Mouse Orthologue:
Alg12
Mouse Description:
asparagine-linked glycosylation 12 homolog (yeast, alpha-1,6-mannosyltransferase) Gene [Source:MGI S

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa45179 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa45179
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115200 Nonsense 349 493 7 9

The following transcripts of ENSDARG00000041199 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 26405170)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 27119491
GRCz11 4 27108779
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAATTACCAAAAGTCACGGATATATAAAATTGGTTCCATAGTTGTGGTT[G/T]GACATTTGATGTTAAATGCAACATACACAAGCATTTCTCTGTATGTTTCC
Long Flanking Sequence:
TCATGCTTGCCCCCTGTGACACGGGATATTGGATGCTAGTATAAACAGCTGGAAGAATATTGTTTGTGTCTGTGGTTCTACTGAGTCGATAGGTGCAGAAATAGTGTCAAACAACCGTGTCTTTTTGGAATATCTTGTCACAAAATGTGGAGAAAATTCTACACAACAGTAATAGTTTTAAGTGTTTACATGTCTTTACTGCACTTCAATAATGCAAATAAAATCGGCATATTCCACATGCCTTGATCCGATTTCTGTTTAGTTTAATTATGACCTTAATCTGATTAAATTAATTAAAATCCCTGTTTACATATTAGACTCTTAATCAGAGTATTGTTTAATCATATTAAAATCAAATTATTGGTGTCCGTGTAAACCTGTTCTCTGTCTCAGGGGTAAGTGGATTATCCTTCACCTCAAATTTTGTCATATTTTTTTGTTACAGATTGAAGAATTACCAAAAGTCACGGATATATAAAATTGGTTCCATAGTTGTGGTT[G/T]GACATTTGATGTTAAATGCAACATACACAAGCATTTCTCTGTATGTTTCCCATCACAACTACCCAGGAGGAAAAGCAATGCAGGAACTACATAGATTAATGCCAACTACAGCAGGTAGGTTAATAGCTTTATTAATATTGAATTATCATTGCAATCCAAACAACCTGATTAAGATGCATACTTGCCACACAGATGTGTCATTACACATCGACGTACTTGCTGCACAAACTGGAGTGTCACGCTTTCTGGAACTAAATAGTAACTGGAGGTGTGTGAGCATCTAACTATCAAATATAATGCTTTTTATATTTTTTGAGTTGCTTGTTTTAATATTTCTTTTTAATTGCTTCATAGATATGACAAGAAGGAGGATTTGACAGTTGAAGATCCAGTAATGAAAACCTATTCACATCTATTAATGGAAGTGAATGCAACAAAGATATTGCTACTCAAAGACTCGCATAAGCCTTTGGTCTTCATTACCGGATATCAAAGCCTTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa18786
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115200 Nonsense 457 493 9 9

The following transcripts of ENSDARG00000041199 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 26405660)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 27119981
GRCz11 4 27109269
KASP Assay ID:
2259-5016.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATATTGCTACTCAAAGACTCGCATAAGCCTTTGGTCTTCATTACCGGATA[T/G]CAAAGCCTTACCTTCGAGATGTTCCATTTCCCACCTCTCAAAATTCAGCT
Long Flanking Sequence:
AGTTGTGGTTGGACATTTGATGTTAAATGCAACATACACAAGCATTTCTCTGTATGTTTCCCATCACAACTACCCAGGAGGAAAAGCAATGCAGGAACTACATAGATTAATGCCAACTACAGCAGGTAGGTTAATAGCTTTATTAATATTGAATTATCATTGCAATCCAAACAACCTGATTAAGATGCATACTTGCCACACAGATGTGTCATTACACATCGACGTACTTGCTGCACAAACTGGAGTGTCACGCTTTCTGGAACTAAATAGTAACTGGAGGTGTGTGAGCATCTAACTATCAAATATAATGCTTTTTATATTTTTTGAGTTGCTTGTTTTAATATTTCTTTTTAATTGCTTCATAGATATGACAAGAAGGAGGATTTGACAGTTGAAGATCCAGTAATGAAAACCTATTCACATCTATTAATGGAAGTGAATGCAACAAAGATATTGCTACTCAAAGACTCGCATAAGCCTTTGGTCTTCATTACCGGATA[T/G]CAAAGCCTTACCTTCGAGATGTTCCATTTCCCACCTCTCAAAATTCAGCTAAACAAAAAGCTTGTGCTTTTAGAAAGACAATCAAACAAAGTAAATGGAGGATTGAACTAAAACTTTGATGTATTCCTTTAGCTAAGGGAAGGGGCCAATAAATGTTTATAAAGTTTTTTGTGAATTATTTTGCTGTTTCTGTTTGCTGAGAGGGTAGGCAGTCCTGAGTTAGTTCTATTACACTAGTCGGGTTAGATCTGCTGCTTGATCTTGCAAACTGACATTTTCTTATTAAATTGTTGTTTGTAGAGCAGTTAGTTTGACCATTTTCTGCAATTTATTATTTCTAGTCATTTCTCACATAGGTTAAAAAAAAAATAACAAAAACAAGCGCATTTCCCCGTTGAAGAATAAGGTCAAAACTACACTGCAAAAAATGCTTTTCTTGCTTAGATTTGTTGTCTTGTTTCCAGTCCAAATATCTAAATATTCCTAAATCAAGAATAATT
Associated Phenotype:
Not determined