Busch Lab

ZMP

crfb7

Ensembl ID:
ENSDARG00000041180
ZFIN ID:
ZDB-GENE-070905-4
Description:
cytokine receptor family member b7 [Source:RefSeq peptide;Acc:NP_001071093]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa1054 Essential Splice Site F2 line generated Not yet available
sa13325 Essential Splice Site Available for shipment Available now
sa14148 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1054
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060362 Essential Splice Site 165 536 4 7
Genomic Location (Zv9):
Chromosome 15 (position 13082234)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 12448583
GRCz11 15 12380000
KASP Assay ID:
554-0957.1 (used for ordering genotyping assays)
KASP Sequence:
ATGGACTAAGTTACTCTGCCATTCTGTATCCAAGAGGACAGGAGAGTAAG[G/A]TTGGTTTTTCAGTGGACATAGCTTAATGACAAACCCAATGGACACCTTGA
Long Flanking Sequence:
ACCTACAATGAAAGTAAAAATTGAACTGATAAGTGGAAATAACGAATCTTCCTGGTTGGTGATAAGAAGAATTCGTTTAGATTATAGTAAGTATGGACTTTTTATGCAATTATTTTATATATTGGCAATGAAGTAGCTAGTTTCTACATTTATATGACTTTATATTATTTTTAAAAGTAAGCATGCCCCCAAAACCAACCATCATTGGGGGATGAACAAGTCTTACATAAAAAATGCATATAAATTACGAAAGAGCCACTTCATCAAAAAGTTACGAATTATTGTGTTTACATCATATGACAAACTGTATATTTTCAAAAATTTTGTAAGGACGGTTTTCTTTTTGTGTTTTAGTTAAGCTGTTGTCTCCAGACTTTGACCTGTTCTCAGGGCCAAATACGGTGAAGGTTAAGATTCACAGAAAGCCATTTCTCAAAGAGCTTTTTCCATATGGACTAAGTTACTCTGCCATTCTGTATCCAAGAGGACAGGAGAGTAAG[G/A]TTGGTTTTTCAGTGGACATAGCTTAATGACAAACCCAATGGACACCTTGATGATGTCTTGGCATCAAAAAAGTTAAATTTGGGCTGTCTATAGTGGGAGCCAAATAGACAAATAGGCCAAAACTTGACTCGTTGTCAAATAGACAGAAATAAATAACTACACATATAAAATCTGTCTGTTTGACAACTATAGTGTACTGTAATTTTGGGCTATTTTAGATGTCTATTCGATTTTCACTGACAGCTCAATTTTAGCCTTGTTTTAGCTAAGTTATCTACGTTTAGATGTCTATTAAACATTTTTTTTTTTTTTTTGCTGGGTGGTAAAAACAACATCAAAAAACATCTAAAATGTGAATCAATTTAATGTAAAATTGTTGTCATCCATTTGATATCCACACTTTGATGCTCTTTTGAGTAATAAAATAATGGCACAAAAATTTACATCTTTCATTGCCTTTTTTTGACGTCAATATTAGATGTCAGTTTGATGTTGTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13325
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060362 Essential Splice Site 165 536 4 7
Genomic Location (Zv9):
Chromosome 15 (position 13082234)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 12448583
GRCz11 15 12380000
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATGGACTAAGTTACTCTGCCATTCTGTWTCCRAGAGGACAGGAGAGTAAG[G/A]TTGGTTTTTCAGTGGACATAGCTTAATGACAAACCCAATGGACACCTTRA
Long Flanking Sequence:
ACCTACAATGAAAGTAAAAATTGAACTGATAAGTGGAAATAACGAATCTTCCTGGTTGGTGATAAGAAGAATTCGTTTAGATTATAGTAAGTATGGACTTTTTATGCAATTATTTTATATATTGGCAATGAAGTAGCTAGTTTCTACATTTATATGACTTTATATTATTTTTAAAAGTAAGCATGCCCCCAAAACCAACCATCATTGGGGGATGAACAAGTCTTACATAAAAAATGCATATAAATTACGAAAGAGCCACTTCATCAAAAAGTTACGAATTATTGTGTTTACATCATATGACAAACTGTATATTTTCAAAAATTTTGTAAGGACGGTTTTCTTTTTGTGTTTTAGTTAAGCTGTTGTCTCCAGACTTTGACCTGTTCTCAGGGCCAAATACGGTGAAGGTTAAGATTCACAGAAAGCCATTTCTCAAAGAGCTTTTTCCATATGGACTAAGTTACTCTGCCATTCTGTATCCAAGAGGACAGGAGAGTAAG[G/A]TTGGTTTTTCAGTGGACATAGCTTAATGACAAACCCAATGGACACCTTGATGATGTCTTGGCATCAAAAAAGTTAAATTTGGGCTGTCTATAGTGGGAGCCAAATAGACAAATAGGCCAAAACTTGACTCGTTGTCAAATAGACAGAAATAAATAACTACACATATAAAATCTGTCTGTTTGACAACTATAGTGTACTGTAATTTTGGGCTATTTTAGATGTCTATTCGATTTTCACTGACAGCTCAATTTTAGCCTTGTTTTAGCTAAGTTATCTACGTTTAGATGTCTATTAAACATTTTTTTTTTTTTTTTGCTGGGTGGTAAAAACAACATCAAAAAACATCTAAAATGTGAATCAATTTAATGTAAAATTGTTGTCATCCATTTGATATCCACACTTTGATGCTCTTTTGAGTAATAAAATAATGGCACAAAAATTTACATCTTTCATTGCCTTTTTTTGACGTCAATATTAGATGTCAGTTTGATGTTGTTTTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4593
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060362 Nonsense 268 536 7 7
Genomic Location (Zv9):
Chromosome 15 (position 13076534)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 12454283
GRCz11 15 12385700
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTATTCATCAGAAATTGGCTGTGAATGGCTGGCTCCCAATGAATGTAGGA[C/T]AAACCGAGGTGGAATCGGTCACTCAGAAGGGATGGCTACTGAACAGCAAC
Long Flanking Sequence:
ATTTTTAACAAATTTCTGAGCAGAAGTAGCAAAAAATGTCCTCAAATTCCTTCTGGCCCTACTTATAAATTTTGATAAACAGCCAATATCTTAATAATAGGCAGGTAATAAGCCACTAGTCATTAATGATAATTGGTCTCAATTCTAAAGTGTCACCTTTTAAAAGTTATCAGTTAGTGTATTTATTTTAATTAGAATTAGAATTATATTATTAATGTATTATCATTATTAATGTAGAAAAAAGTTGTGCTGCTTCACAATTTGTTTGTAAAAAATGAAGGATTAATTGATAGATGCTTTTTTAAAATAGTTTGTAACATTATAAATGATTTTACTGTAATTTAATAGAATAAATTGAAAATACCCCATGCATCTGATTAAACCATTCAAATTTATTTCACTTCTGTTACGGTCAGATTAATTATAAAGTGTTCACCATATGTTCTCCATTTATTCATCAGAAATTGGCTGTGAATGGCTGGCTCCCAATGAATGTAGGA[C/T]AAACCGAGGTGGAATCGGTCACTCAGAAGGGATGGCTACTGAACAGCAACAAAATCGCAGAAAAGACCAAAGCATTCGATGAAATAGAGGAGCTTTCTGAGGATGAAAAAGAGAGAAGGGAAAGCACTGACAGCGGCGTGAGCATCGGCCAGCAGGACTCGATCAAAAACAGACCCCAAAGAGAGGAGGACAGCGGCTGTGGAAGTCTCACAGGAACCGAGGACAGCCTTAGCAGTGGAAGAAGAAGCCTTGAGGAGCTTCCTTTCCTGGATGGAGGAGGAAACAGCAGTAGTGTTGAAGGAACAAGAGAGGACAGTGGATTGGGAATTCAAACCCAAGATATTTCTGACAAACCCAAGCCTATGCATGATGATCTCTTATCTGAGATTGTAGTAATTGGGGATGGGTATCGTAGTCAGAGTCCTTCAGCTGAGGCTGAAACCGAAACAACCATTCAATGTGATGAAGACGCTAATATGGTTAGTCGCACCAATGGCTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14148
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060362 Nonsense 435 536 7 7
Genomic Location (Zv9):
Chromosome 15 (position 13076033)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 12454784
GRCz11 15 12386201
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCATTCAATGTGATGAAGACGCTAATATGGTTAGTCGCAYCAATGGCTAT[C/T]GATCTGGTCAAGTCACATGCTTGTGTTCTGACTCCGAAACTTGCATGTGG
Long Flanking Sequence:
AAACCGAGGTGGAATCGGTCACTCAGAAGGGATGGCTACTGAACAGCAACAAAATCGCAGAAAAGACCAAAGCATTCGATGAAATAGAGGAGCTTTCTGAGGATGAAAAAGAGAGAAGGGAAAGCACTGACAGCGGCGTGAGCATCGGCCAGCAGGACTCGATCAAAAACAGACCCCAAAGAGAGGAGGACAGCGGCTGTGGAAGTCTCACAGGAACCGAGGACAGCCTTAGCAGTGGAAGAAGAAGCCTTGAGGAGCTTCCTTTCCTGGATGGAGGAGGAAACAGCAGTAGTGTTGAAGGAACAAGAGAGGACAGTGGATTGGGAATTCAAACCCAAGATATTTCTGACAAACCCAAGCCTATGCATGATGATCTCTTATCTGAGATTGTAGTAATTGGGGATGGGTATCGTAGTCAGAGTCCTTCAGCTGAGGCTGAAACCGAAACAACCATTCAATGTGATGAAGACGCTAATATGGTTAGTCGCACCAATGGCTAT[C/T]GATCTGGTCAAGTCACATGCTTGTGTTCTGACTCCGAAACTTGCATGTGGTGCAAAACCAGGAAGCACCTTACAGACTGTGATTCATTTTCTCACAAACAAACTGTTAATGACAATGATAGATCAAGCTATTTGAAAAAATCTCCTTTAGAGACTGTGAATATGTTTGGACTGGATGATCTATCCTGCCATTCAGACAAAACAGAGGAGTCGTCACTTTTCATTACATGTCCACTACTTTTAAAAGAGCCTTACAAGCTGGACACTTTGCCTCTTACATTAGGAGACGTAGAGCTGACATTTACGTGAGGCTTTTTCAGGTTGAACTAGGCTATTATTATGCATTTGTGCTAACAGATATTTATTTAGAATGGTGGCAGAGACGTGCTATATTTGCTAGGCCCTCAAATGAAGAACCAGCTTTTGTCACTTCCTTCATGCGTCAGGCCAGCGTTTTTGGTTAAATGCTGAGAAAAGACGAGATATGAAGAGTGTGAAATC
Associated Phenotype:
Not determined