Busch Lab

ZMP

rcan1

Ensembl ID:
ENSDARG00000041157
ZFIN ID:
ZDB-GENE-030131-8292
Description:
Rcan1 protein [Source:UniProtKB/TrEMBL;Acc:Q6DGB1]
Human Orthologue:
RCAN1
Human Description:
regulator of calcineurin 1 [Source:HGNC Symbol;Acc:3040]
Mouse Orthologue:
Rcan1
Mouse Description:
regulator of calcineurin 1 Gene [Source:MGI Symbol;Acc:MGI:1890564]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa1725 Missense, Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25510
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060324 None None 171 None 5
ENSDART00000123271 Nonsense 12 215 1 4
Genomic Location (Zv9):
Chromosome 1 (position 2692843)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150324.1 9820
GRCz11 KN150324.1 9820
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAGAAAACTCCATCATGCATCTCAAGACTACAAAGTGCAGTAATTCCTG[T/A]CTGGTGGCCACAGTGGTGGACTATGAGATATTCACGCGCACACACATTCG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2014
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060324 Nonsense 94 171 3 5
ENSDART00000123271 Nonsense 120 215 3 4
Genomic Location (Zv9):
Chromosome 1 (position 2696345)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150324.1 13322
GRCz11 KN150324.1 13322
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCAGTTCCTGATTTCTCCTCCAGCGTCGCCCCCTGTTGGCTGGGCGCAGT[C/A]GCAGGACGCAATGCCCGTCATCAACTATGACCTGTTGTGTGCCGTGTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1725
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Missense, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060324 Missense 170 171 5 5
ENSDART00000123271 Nonsense 197 215 4 4
Genomic Location (Zv9):
Chromosome 1 (position 2702626)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150324.1 19603
GRCz11 KN150324.1 19603
KASP Assay ID:
554-1671.1 (used for ordering genotyping assays)
KASP Sequence:
CTCGGCCCAAAATCATCCAGACACGCCGCCCAGATTTCGTCCCGTCGGTG[G/A]ACCAGTGAGCATTTCCTGACCCGTTCATCTCCGCGACCCAAACCGGGGAG
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461