Busch Lab

ZMP

morf4l1

Ensembl ID:
ENSDARG00000041155
ZFIN ID:
ZDB-GENE-040718-348
Description:
mortality factor 4-like protein 1 [Source:RefSeq peptide;Acc:NP_001002604]
Human Orthologues:
MORF4L1, MORF4L2
Human Descriptions:
mortality factor 4 like 1 [Source:HGNC Symbol;Acc:16989]
mortality factor 4 like 2 [Source:HGNC Symbol;Acc:16849]
Mouse Orthologues:
Morf4l1, Morf4l2
Mouse Descriptions:
mortality factor 4 like 1 Gene [Source:MGI Symbol;Acc:MGI:1096551]
mortality factor 4 like 2 Gene [Source:MGI Symbol;Acc:MGI:1927167]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa25062 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29023
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060319 Essential Splice Site None 195 None 12
ENSDART00000139441 Essential Splice Site 14 323 None 12
Genomic Location (Zv9):
Chromosome 18 (position 19814920)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 20045143
GRCz11 18 20034209
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATCTGTGAATGGCGCCTAAACAGGACCCTAAACCTAAATTTCAAGAAGG[T/C]AAGATGCGCTTTGTTTCATCCACGAGAGTCACCCGTCGATCGGGGATCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25062
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060319 None None 195 2 12
ENSDART00000139441 Nonsense 16 323 2 12
Genomic Location (Zv9):
Chromosome 18 (position 19815866)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 20046089
GRCz11 18 20035155
KASP Assay ID:
554-7293.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTAGTGGATGTCATTGTATATTAATATTTCTGATGTTTTTTCAGGTGAA[C/T]GAGTGCTGTGCTTTCATGGGCCATTGCTATACGAAGCTAAGGTACCTGAA
Associated Phenotype:
Not determined